Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009346.1

Orthogroup ID

OG0008520

Physical Location & Seq

Genomic Coordinates Forward (+)

849 .. 3224

Gene Structure 2376 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009346.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1227 bp

atgggcggttgggctattgctgtgcacggtggcgctggtgtcgacccaaatctccctctcgagcgccaagaacaagccaaacagctcctcactcgctgcctcaatctcggaatctctgctctccgttctgatcttcccgccattgatgttgttgaacttgttgttagggaattggaaacggatccgtttttcaattccggccgtggatccgccctgaatgaaaatggcagggttgagatggaagccagcatcatggatggacccaaaagacgatgcggcgccgtatcggggttgagcacagtcaagaacccgatctcgcttgcccgactcgtcatggataagtccccgcattcctaccttgccttctccggcgccgaaagcttcgccaggcaacagggcgttgagctggtggacaatgactattttatcacggaggagaatgtggggatgctcaagttggccaaggaagccaacaccatcttgtttgattacagaatcccacttggaacggagacttgcgctgctggtgtggagagcccgatacaaatgaacgggctgcccataagcgtgtacgcacccgagacggtcggatgtgtggtcgtggactgccagggccgctgcgcagctgccacctctaccggtggactcatgaacaaaatgacaggtcgcattggggactcgccactcattggggctggcacctacgcgtgtgacctctgtggtgtctcttgcacaggagagggagaggccatcatacgcgggacactggcgcgtgaagttgctgctgtgatggagtacaagggcttaggccttcaggacgctgtggactttgtgatcaagaacaggctcgatgaaggaaaggccggactcattgctgtgtccaacaaaggagaagtggcttgtgggtttaactgctgcggaatgttcagggggagtgcaacagaggatgggttcatggaggtcctaggttttgcctctgaaattttgggttttctctatgctggttgggccgtctcgtccggcggcgccccggcgctggtgtggacctctggtctcaccagtgcatggaggctgttgccggacgggtatttggtgtcttcgtggtggtggaggcggaagccttgcaggcaacgttcctctgccttgtttgaggtcgacggattagctaatggtggtttcggtctgggcgagggtgaggggcagattcgactggatcgagttgtgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004067 GO:0004175 GO:0004190 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0009056 GO:0009057 GO:0016787 GO:0016810 GO:0016811 GO:0019538 GO:0030163 GO:0043170 GO:0044238 GO:0070001 GO:0070011 GO:0071704 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Asparaginase_2

Protein Analysis

408

Amino Acids

43.25

Weight (kDa)

4.93

Isoelectric Point (pI)

34.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008520)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G16150
fragaria_vesca	FvH4_2g33770
malus_domestica	MD08G1092600.v1.1 MD15G1077000.v1.1
prunus_persica	Prupe.1G430400_v2.0.a1 Prupe.1G430400_v2.0.a1 Prupe.1G430400_v2.0.a1
pyrus_communis	pycom08g07530 pycom15g07170
rosa_chinensis	RchiOBHm_Chr4g0445551 RchiOBHm_Chr6g0308781
rosa_laevigata	RLG00000010619
rosa_multiflora	Rmu_sc0000871.1_g000036 Rmu_sc0009346.1_g000001 Rmu_sc0027152.1_g000001 Rmu_sc0027153.1_g000001 Rmu_sc0027154.1_g000001
rosa_roxburghii	Rroxscaffold_7G00159940
rosa_rugosa	Rorug06G0368100
rosa_samantha	Rh4DG432200 Rh6CG494400 Rh6DG479700
rosa_wichuraiana	Rw6G041790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	622
AccB1I	GGYRCC	4 cut(s)	278, 371, 698, 1025
AccB7I	CCANNNNNTGG	2 cut(s)	689, 1065
AccI	GTMKAC	2 cut(s)	42, 1155
AccII	CGCG	3 cut(s)	707, 759, 772
AclI	AACGTT	1 cut(s)	1132
AclWI	GGATC	5 cut(s)	176, 189, 201, 214, 1221
AcoI	YGGCCR	2 cut(s)	199, 459
AcsI	RAATTY	1 cut(s)	981
AcuI	CTGAAG	1 cut(s)	797
AcyI	GRCGYC	3 cut(s)	279, 372, 1026
AfaI	GTAC	2 cut(s)	572, 797
AfiI	CCNNNNNNNGG	4 cut(s)	288, 689, 1036, 1065
AflIII	ACRYGT	1 cut(s)	705
AgeI	ACCGGT	1 cut(s)	638
AgsI	TTSAA	2 cut(s)	155, 193
AhdI	GACNNNNNGTC	1 cut(s)	1050
AjnI	CCWGG	2 cut(s)	386, 609
AluBI	AGCT	5 cut(s)	85, 381, 406, 626, 1166
AluI	AGCT	5 cut(s)	85, 381, 406, 626, 1166
Alw21I	GWGCWC	2 cut(s)	27, 299
Alw26I	GTCTC	5 cut(s)	506, 575, 730, 1018, 1058
Alw44I	GTGCAC	1 cut(s)	23
AlwI	GGATC	5 cut(s)	176, 189, 201, 214, 1221
Ama87I	CYCGRG	2 cut(s)	59, 578
AoxI	GGCC	7 cut(s)	199, 459, 613, 747, 808, 861, 1008
ApaLI	GTGCAC	1 cut(s)	23
ApeKI	GCWGC	8 cut(s)	96, 521, 556, 618, 623, 626, 782, 915
ApoI	RAATTY	1 cut(s)	981
AsiGI	ACCGGT	1 cut(s)	638
AspA2I	CCTAGG	1 cut(s)	964
AspLEI	GCGC	9 cut(s)	35, 66, 281, 374, 521, 623, 772, 1028, 1036
AspS9I	GGNCC	5 cut(s)	260, 613, 961, 1008, 1044
AsuC2I	CCSGG	1 cut(s)	1031
AsuHPI	GGTGA	2 cut(s)	1048, 1205
AvaI	CYCGRG	2 cut(s)	59, 578
AvaII	GGWCC	3 cut(s)	260, 961, 1044
AvrII	CCTAGG	1 cut(s)	964
BaeGI	GKGCMC	1 cut(s)	27
BalI	TGGCCA	1 cut(s)	461
BamHI	GGATCC	2 cut(s)	181, 206
BanI	GGYRCC	4 cut(s)	278, 371, 698, 1025
BanII	GRGCYC	1 cut(s)	539
BbsI	GAAGAC	1 cut(s)	1089
Bbv12I	GWGCWC	2 cut(s)	27, 299
BbvI	GCAGC	8 cut(s)	83, 508, 543, 605, 613, 635, 769, 902
BccI	CCATC	6 cut(s)	232, 251, 485, 758, 784, 941
BceAI	ACGGC	3 cut(s)	186, 266, 995
BciT130I	CCWGG	2 cut(s)	388, 611
BclI	TGATCA	1 cut(s)	834
BcnI	CCSGG	1 cut(s)	1031
BcoDI	GTCTC	5 cut(s)	506, 575, 730, 1018, 1058
BfaI	CTAG	1 cut(s)	965
BfoI	RGCGCY	6 cut(s)	36, 67, 282, 375, 1029, 1037
BglI	GCCNNNNNGGC	1 cut(s)	1126
BlnI	CCTAGG	1 cut(s)	964
Bme1390I	CCNGG	3 cut(s)	388, 611, 1031
Bme18I	GGWCC	3 cut(s)	260, 961, 1044
BmeRI	GACNNNNNGTC	1 cut(s)	1050
BmeT110I	CYCGRG	2 cut(s)	59, 578
BmgT120I	GGNCC	5 cut(s)	260, 613, 961, 1008, 1044
BmiI	GGNNCC	7 cut(s)	183, 208, 262, 280, 373, 700, 1027
BmrFI	CCNGG	3 cut(s)	388, 611, 1031
BmsI	GCATC	3 cut(s)	258, 263, 438
BpiI	GAAGAC	1 cut(s)	1089
Bpu10I	CCTNAGC	1 cut(s)	805
BpuEI	CTTGAG	1 cut(s)	437
BpuMI	CCSGG	1 cut(s)	1031
BsaHI	GRCGYC	3 cut(s)	279, 372, 1026
BsaI	GGTCTC	1 cut(s)	1058
BsaJI	CCNNGG	5 cut(s)	202, 462, 610, 964, 1029
BsaWI	WCCGGW	1 cut(s)	638
Bsc4I	CCNNNNNNNGG	4 cut(s)	288, 689, 1036, 1065
Bse118I	RCCGGY	1 cut(s)	638
Bse1I	ACTGG	3 cut(s)	771, 1059, 1215
Bse3DI	GCAATG	1 cut(s)	870
BseBI	CCWGG	2 cut(s)	388, 611
BseDI	CCNNGG	5 cut(s)	202, 462, 610, 964, 1029
BseGI	GGATG	4 cut(s)	262, 453, 596, 952
BseLI	CCNNNNNNNGG	4 cut(s)	288, 689, 1036, 1065
BseMI	GCAATG	1 cut(s)	870
BseNI	ACTGG	3 cut(s)	771, 1059, 1215
BseRI	GAGGAG	2 cut(s)	77, 449
BseSI	GKGCMC	1 cut(s)	27
BseX3I	CGGCCG	1 cut(s)	199
BseXI	GCAGC	8 cut(s)	83, 508, 543, 605, 613, 635, 769, 902
Bsh1236I	CGCG	3 cut(s)	707, 759, 772
Bsh1285I	CGRYCG	2 cut(s)	202, 588
BshFI	GGCC	7 cut(s)	201, 461, 615, 749, 810, 863, 1010
BshNI	GGYRCC	4 cut(s)	278, 371, 698, 1025
BshTI	ACCGGT	1 cut(s)	638
BsiEI	CGRYCG	2 cut(s)	202, 588
BsiHKAI	GWGCWC	2 cut(s)	27, 299
BsiHKCI	CYCGRG	2 cut(s)	59, 578
BsiSI	CCGG	7 cut(s)	198, 369, 639, 864, 1020, 1031, 1079
BslFI	GGGAC	3 cut(s)	328, 689, 775
BslI	CCNNNNNNNGG	4 cut(s)	288, 689, 1036, 1065
BsmAI	GTCTC	5 cut(s)	506, 575, 730, 1018, 1058
BsmBI	CGTCTC	2 cut(s)	575, 1018
BsmFI	GGGAC	3 cut(s)	328, 689, 775
BsmI	GAATGC	1 cut(s)	349
BsnI	GGCC	7 cut(s)	201, 461, 615, 749, 810, 863, 1010
Bso31I	GGTCTC	1 cut(s)	1058
BsoBI	CYCGRG	2 cut(s)	59, 578
Bsp1286I	GDGCHC	3 cut(s)	27, 299, 539
Bsp143I	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
BspANI	GGCC	7 cut(s)	201, 461, 615, 749, 810, 863, 1010
BspFNI	CGCG	3 cut(s)	707, 759, 772
BspHI	TCATGA	1 cut(s)	648
BspLI	GGNNCC	7 cut(s)	183, 208, 262, 280, 373, 700, 1027
BspPI	GGATC	5 cut(s)	176, 189, 201, 214, 1221
BspT107I	GGYRCC	4 cut(s)	278, 371, 698, 1025
BspTNI	GGTCTC	1 cut(s)	1058
BsrDI	GCAATG	1 cut(s)	870
BsrFI	RCCGGY	1 cut(s)	638
BsrI	ACTGG	3 cut(s)	771, 1059, 1215
BssAI	RCCGGY	1 cut(s)	638
BssECI	CCNNGG	5 cut(s)	202, 462, 610, 964, 1029
BssMI	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
BssNI	GRCGYC	3 cut(s)	279, 372, 1026
BssT1I	CCWWGG	2 cut(s)	462, 964
Bst2UI	CCWGG	2 cut(s)	388, 611
Bst4CI	ACNGT	3 cut(s)	29, 301, 586
BstACI	GRCGYC	3 cut(s)	279, 372, 1026
BstC8I	GCNNGC	4 cut(s)	247, 321, 697, 1127
BstDEI	CTNAG	1 cut(s)	805
BstDSI	CCRYGG	1 cut(s)	202
BstF5I	GGATG	4 cut(s)	262, 453, 596, 952
BstFNI	CGCG	3 cut(s)	707, 759, 772
BstH2I	RGCGCY	6 cut(s)	36, 67, 282, 375, 1029, 1037
BstHHI	GCGC	9 cut(s)	35, 66, 281, 374, 521, 623, 772, 1028, 1036
BstKTI	GATC	6 cut(s)	133, 184, 209, 315, 837, 1216
BstMAI	GTCTC	5 cut(s)	506, 575, 730, 1018, 1058
BstMBI	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
BstMCI	CGRYCG	2 cut(s)	202, 588
BstMWI	GCNNNNNNNGC	5 cut(s)	378, 467, 615, 1007, 1126
BstNI	CCWGG	2 cut(s)	388, 611
BstSCI	CCNGG	3 cut(s)	386, 609, 1029
BstSLI	GKGCMC	1 cut(s)	27
BstUI	CGCG	3 cut(s)	707, 759, 772
BstV1I	GCAGC	8 cut(s)	83, 508, 543, 605, 613, 635, 769, 902
BstV2I	GAAGAC	1 cut(s)	1089
BstX2I	RGATCY	2 cut(s)	181, 206
BstXI	CCANNNNNNTGG	1 cut(s)	253
BstYI	RGATCY	2 cut(s)	181, 206
BstZI	CGGCCG	1 cut(s)	199
BsuRI	GGCC	7 cut(s)	201, 461, 615, 749, 810, 863, 1010
BtgI	CCRYGG	1 cut(s)	202
BtsCI	GGATG	4 cut(s)	262, 453, 596, 952
BtsIMutI	CAGTG	2 cut(s)	764, 1066
Cac8I	GCNNGC	4 cut(s)	247, 321, 697, 1127
CciI	TCATGA	1 cut(s)	648
CfoI	GCGC	9 cut(s)	35, 66, 281, 374, 521, 623, 772, 1028, 1036
Cfr10I	RCCGGY	1 cut(s)	638
Cfr13I	GGNCC	5 cut(s)	260, 613, 961, 1008, 1044
CseI	GACGC	1 cut(s)	827
Csp6I	GTAC	2 cut(s)	571, 796
CspAI	ACCGGT	1 cut(s)	638
CviAII	CATG	5 cut(s)	253, 334, 649, 955, 1065
CviQI	GTAC	2 cut(s)	571, 796
DdeI	CTNAG	1 cut(s)	805
DinI	GGCGCC	3 cut(s)	280, 373, 1027
DpnI	GATC	6 cut(s)	132, 183, 208, 314, 836, 1215
DpnII	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
DriI	GACNNNNNGTC	1 cut(s)	1050
EaeI	YGGCCR	2 cut(s)	199, 459
EagI	CGGCCG	1 cut(s)	199
Eam1105I	GACNNNNNGTC	1 cut(s)	1050
EciI	GGCGGA	2 cut(s)	199, 1129
EclXI	CGGCCG	1 cut(s)	199
Eco130I	CCWWGG	2 cut(s)	462, 964
Eco147I	AGGCCT	1 cut(s)	810
Eco24I	GRGCYC	1 cut(s)	539
Eco31I	GGTCTC	1 cut(s)	1058
Eco47I	GGWCC	3 cut(s)	260, 961, 1044
Eco52I	CGGCCG	1 cut(s)	199
Eco57I	CTGAAG	1 cut(s)	797
Eco88I	CYCGRG	2 cut(s)	59, 578
EcoO109I	RGGNCCY	1 cut(s)	961
EcoRII	CCWGG	2 cut(s)	386, 609
EcoT14I	CCWWGG	2 cut(s)	462, 964
EcoT38I	GRGCYC	1 cut(s)	539
EgeI	GGCGCC	3 cut(s)	280, 373, 1027
EheI	GGCGCC	3 cut(s)	280, 373, 1027
ErhI	CCWWGG	2 cut(s)	462, 964
Esp3I	CGTCTC	2 cut(s)	575, 1018
FaeI	CATG	5 cut(s)	256, 337, 652, 958, 1068
FaiI	YATR	8 cut(s)	254, 335, 563, 650, 755, 956, 999, 1066
FaqI	GGGAC	3 cut(s)	328, 689, 775
FatI	CATG	5 cut(s)	252, 333, 648, 954, 1064
FauI	CCCGC	3 cut(s)	145, 354, 752
FbaI	TGATCA	1 cut(s)	834
FblI	GTMKAC	2 cut(s)	42, 1155
FokI	GGATG	4 cut(s)	269, 460, 603, 959
FriOI	GRGCYC	1 cut(s)	539
FspBI	CTAG	1 cut(s)	965
FspI	TGCGCA	1 cut(s)	622
GlaI	GCGC	9 cut(s)	34, 65, 280, 373, 520, 622, 771, 1027, 1035
HaeII	RGCGCY	6 cut(s)	36, 67, 282, 375, 1029, 1037
HaeIII	GGCC	7 cut(s)	201, 461, 615, 749, 810, 863, 1010
HapII	CCGG	7 cut(s)	198, 369, 639, 864, 1020, 1031, 1079
HgaI	GACGC	1 cut(s)	827
HhaI	GCGC	9 cut(s)	35, 66, 281, 374, 521, 623, 772, 1028, 1036
Hin1I	GRCGYC	3 cut(s)	279, 372, 1026
Hin1II	CATG	5 cut(s)	256, 337, 652, 958, 1068
Hin6I	GCGC	9 cut(s)	33, 64, 279, 372, 519, 621, 770, 1026, 1034
HinP1I	GCGC	9 cut(s)	33, 64, 279, 372, 519, 621, 770, 1026, 1034
HincII	GTYRAC	2 cut(s)	43, 1156
HindII	GTYRAC	2 cut(s)	43, 1156
HindIII	AAGCTT	1 cut(s)	379
HinfI	GANTC	7 cut(s)	111, 327, 495, 645, 677, 867, 1204
HpaII	CCGG	7 cut(s)	198, 369, 639, 864, 1020, 1031, 1079
HphI	GGTGA	2 cut(s)	1048, 1205
Hpy166II	GTNNAC	9 cut(s)	25, 43, 412, 571, 604, 644, 826, 1044, 1156
Hpy188I	TCNGA	4 cut(s)	110, 130, 590, 979
Hpy188III	TCNNGA	5 cut(s)	59, 304, 649, 815, 838
Hpy8I	GTNNAC	9 cut(s)	25, 43, 412, 571, 604, 644, 826, 1044, 1156
Hpy99I	CGWCG	1 cut(s)	1160
HpyAV	CCTTC	3 cut(s)	373, 821, 848
HpyCH4III	ACNGT	3 cut(s)	29, 301, 586
HpyCH4IV	ACGT	1 cut(s)	1132
HpyCH4V	TGCA	5 cut(s)	25, 732, 938, 1064, 1125
HpyF10VI	GCNNNNNNNGC	5 cut(s)	378, 467, 615, 1007, 1126
HpyF3I	CTNAG	1 cut(s)	805
HpySE526I	ACGT	1 cut(s)	1132
Hsp92I	GRCGYC	3 cut(s)	279, 372, 1026
Hsp92II	CATG	5 cut(s)	256, 337, 652, 958, 1068
HspAI	GCGC	9 cut(s)	33, 64, 279, 372, 519, 621, 770, 1026, 1034
KasI	GGCGCC	3 cut(s)	278, 371, 1025
Ksp22I	TGATCA	1 cut(s)	834
Kzo9I	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
LmnI	GCTCC	1 cut(s)	90
Lsp1109I	GCAGC	8 cut(s)	83, 508, 543, 605, 613, 635, 769, 902
LweI	GCATC	3 cut(s)	258, 263, 438
MaeI	CTAG	1 cut(s)	965
MaeII	ACGT	1 cut(s)	1132
MaeIII	GTNAC	1 cut(s)	710
MalI	GATC	6 cut(s)	132, 183, 208, 314, 836, 1215
MboI	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
MboII	GAAGA	2 cut(s)	125, 1089
MflI	RGATCY	2 cut(s)	181, 206
MhlI	GDGCHC	3 cut(s)	27, 299, 539
MlsI	TGGCCA	1 cut(s)	461
MluCI	AATT	3 cut(s)	170, 193, 981
MluI	ACGCGT	1 cut(s)	705
MluNI	TGGCCA	1 cut(s)	461
Mly113I	GGCGCC	3 cut(s)	279, 372, 1026
MlyI	GAGTC	4 cut(s)	321, 639, 671, 861
MmeI	TCCRAC	2 cut(s)	568, 906
Mox20I	TGGCCA	1 cut(s)	461
MscI	TGGCCA	1 cut(s)	461
MseI	TTAA	1 cut(s)	909
MslI	CAYNNNNRTG	2 cut(s)	566, 875
Msp20I	TGGCCA	1 cut(s)	461
MspA1I	CMGCKG	2 cut(s)	618, 626
MspI	CCGG	7 cut(s)	198, 369, 639, 864, 1020, 1031, 1079
MspR9I	CCNGG	3 cut(s)	388, 611, 1031
Mva1269I	GAATGC	1 cut(s)	349
MvaI	CCWGG	2 cut(s)	388, 611
MvnI	CGCG	3 cut(s)	707, 759, 772
MwoI	GCNNNNNNNGC	5 cut(s)	378, 467, 615, 1007, 1126
NarI	GGCGCC	3 cut(s)	279, 372, 1026
NciI	CCSGG	1 cut(s)	1031
NdeII	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
NlaIII	CATG	5 cut(s)	256, 337, 652, 958, 1068
NlaIV	GGNNCC	7 cut(s)	183, 208, 262, 280, 373, 700, 1027
NmuCI	GTSAC	1 cut(s)	710
NsbI	TGCGCA	1 cut(s)	622
PaeR7I	CTCGAG	1 cut(s)	59
PagI	TCATGA	1 cut(s)	648
PceI	AGGCCT	1 cut(s)	810
PcsI	WCGNNNNNNNCGW	2 cut(s)	1185, 1213
PctI	GAATGC	1 cut(s)	349
PfeI	GAWTC	3 cut(s)	111, 495, 1204
PflMI	CCANNNNNTGG	2 cut(s)	689, 1065
PinAI	ACCGGT	1 cut(s)	638
PleI	GAGTC	4 cut(s)	321, 639, 671, 861
PluTI	GGCGCC	3 cut(s)	282, 375, 1029
PpsI	GAGTC	4 cut(s)	321, 639, 671, 861
PpuMI	RGGWCCY	1 cut(s)	961
Psp1406I	AACGTT	1 cut(s)	1132
Psp5II	RGGWCCY	1 cut(s)	961
Psp6I	CCWGG	2 cut(s)	386, 609
PspGI	CCWGG	2 cut(s)	386, 609
PspN4I	GGNNCC	7 cut(s)	183, 208, 262, 280, 373, 700, 1027
PspPI	GGNCC	5 cut(s)	260, 613, 961, 1008, 1044
PspPPI	RGGWCCY	1 cut(s)	961
PsuI	RGATCY	2 cut(s)	181, 206
PvuII	CAGCTG	1 cut(s)	626
RsaI	GTAC	2 cut(s)	572, 797
RsaNI	GTAC	2 cut(s)	571, 796
RseI	CAYNNNNRTG	2 cut(s)	566, 875
SalI	GTCGAC	2 cut(s)	41, 1154
SaqAI	TTAA	1 cut(s)	909
Sau3AI	GATC	6 cut(s)	130, 181, 206, 312, 834, 1213
Sau96I	GGNCC	5 cut(s)	260, 613, 961, 1008, 1044
SchI	GAGTC	4 cut(s)	321, 639, 671, 861
ScrFI	CCNGG	3 cut(s)	388, 611, 1031
SduI	GDGCHC	3 cut(s)	27, 299, 539
SfaNI	GCATC	3 cut(s)	258, 263, 438
SfoI	GGCGCC	3 cut(s)	280, 373, 1027
Sfr274I	CTCGAG	1 cut(s)	59
SinI	GGWCC	3 cut(s)	260, 961, 1044
SlaI	CTCGAG	1 cut(s)	59
SmiMI	CAYNNNNRTG	2 cut(s)	566, 875
SmlI	CTYRAG	2 cut(s)	59, 452
SmoI	CTYRAG	2 cut(s)	59, 452
Sse9I	AATT	3 cut(s)	170, 193, 981
SseBI	AGGCCT	1 cut(s)	810
SspDI	GGCGCC	3 cut(s)	278, 371, 1025
SspMI	CTAG	1 cut(s)	965
StuI	AGGCCT	1 cut(s)	810
StyD4I	CCNGG	3 cut(s)	386, 609, 1029
StyI	CCWWGG	2 cut(s)	462, 964
TaaI	ACNGT	3 cut(s)	29, 301, 586
TaiI	ACGT	1 cut(s)	1135
TaqI	TCGA	6 cut(s)	42, 60, 849, 1155, 1207, 1216
TaqII	GACCGA	1 cut(s)	1169
TasI	AATT	3 cut(s)	170, 193, 981
TatI	WGTACW	1 cut(s)	795
TauI	GCSGC	3 cut(s)	279, 618, 1026
TfiI	GAWTC	3 cut(s)	111, 495, 1204
Tru1I	TTAA	1 cut(s)	909
Tru9I	TTAA	1 cut(s)	909
TscAI	CASTG	2 cut(s)	771, 1066
TseFI	GTSAC	1 cut(s)	710
TseI	GCWGC	8 cut(s)	96, 521, 556, 618, 623, 626, 782, 915
Tsp45I	GTSAC	1 cut(s)	710
TspDTI	ATGAA	5 cut(s)	234, 563, 665, 867, 943
TspGWI	ACGGA	6 cut(s)	113, 174, 194, 446, 524, 1173
TspRI	CASTG	2 cut(s)	771, 1066
Van91I	CCANNNNNTGG	2 cut(s)	689, 1065
VneI	GTGCAC	1 cut(s)	23
VpaK11BI	GGWCC	3 cut(s)	260, 961, 1044
XapI	RAATTY	1 cut(s)	981
XhoI	CTCGAG	1 cut(s)	59
XmaJI	CCTAGG	1 cut(s)	964
XmiI	GTMKAC	2 cut(s)	42, 1155
XspI	CTAG	1 cut(s)	965

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.