Rmu_sc0010744.1_g000004

4Fe-4S single cluster domain of Ferredoxin I

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010744.1
Physical Location & Seq
Reverse (-)
7394 .. 8944
1551 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010744.1_g000004.1.cds

Sequence Viewer

Length: 894 bp
atgtctgttgtagcagcagtctcaatttcccaattttcagtaccaaaaggtttccaagttcaacaccagttcaccacaagcaagcctatcttgaggcagggatgcagtggaataagatgttgtaacaaagagtcaggggaaagagcaaatacaatagggaagaattactatgaattacttggagttgctgttgattcaaacccccagataatcaaacaagcttataggaatttgcaaaagaaatatcacccagatattgcaggccaagagggtcatgagtataccctaaagctgaatgaagcctataaggttctgattagggagaatctgaggaaggaatatgatgcttctattggtcaaaggagagtaagtactgtcagaggaaacagctcaacctttgatggcagctcatggaatggagttttgagaccccaagctctctttgttgatgaaaatgcttgcataggttgcagacaatgtgtgcaccaagcaagtgctacctacatgtttgatgagtctctcggatgtgcaagggttaaacttcaatacggtgacgatgatctaaagattgaggtatcagttgactcatgccctgtgaactgcattcattgggtggaaagagaagaactgccagtgctcgagttcctcatccagcctcggccaacagaaggacatggaatatttggaggaggttgggaaagaccagcaaatgtgttcatggctgctaagtcattcaataagcaactgaaagaggaggctgaaaatggaaaccatcaccgaaatacaagtgagagtgtggaagaagaaacccctgctcaagcaaaggcgcgggccgaagcaagtatgaagatcaagatggaagcgttctcaaaattctggcactggcaaaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

297

Amino Acids

33.48

Weight (kDa)

7.59

Isoelectric Point (pI)

43.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 281
AccII CGCG 1 cut(s) 829
AciI CCGC 1 cut(s) 829
AcoI YGGCCR 1 cut(s) 659
AcsI RAATTY 2 cut(s) 229, 872
AfaI GTAC 2 cut(s) 42, 373
AfiI CCNNNNNNNGG 1 cut(s) 668
AflIII ACRYGT 1 cut(s) 504
AgsI TTSAA 4 cut(s) 62, 198, 545, 736
AluBI AGCT 5 cut(s) 221, 292, 390, 408, 437
AluI AGCT 5 cut(s) 221, 292, 390, 408, 437
Alw21I GWGCWC 2 cut(s) 486, 639
Alw26I GTCTC 3 cut(s) 25, 421, 522
Alw44I GTGCAC 1 cut(s) 482
Ama87I CYCGRG 1 cut(s) 638
AoxI GGCC 3 cut(s) 262, 659, 831
ApaLI GTGCAC 1 cut(s) 482
ApeKI GCWGC 3 cut(s) 14, 405, 722
ApoI RAATTY 2 cut(s) 229, 872
AspLEI GCGC 1 cut(s) 829
AspS9I GGNCC 1 cut(s) 831
AsuHPI GGTGA 4 cut(s) 64, 239, 563, 767
AvaI CYCGRG 1 cut(s) 638
BaeGI GKGCMC 1 cut(s) 486
Bbv12I GWGCWC 2 cut(s) 486, 639
BbvI GCAGC 3 cut(s) 26, 417, 709
BccI CCATC 3 cut(s) 395, 780, 850
BcoDI GTCTC 3 cut(s) 25, 421, 522
BisI GCNGC 3 cut(s) 15, 406, 723
BlsI GCNGC 3 cut(s) 16, 407, 724
BmcAI AGTACT 1 cut(s) 373
BmeT110I CYCGRG 1 cut(s) 638
BmgT120I GGNCC 1 cut(s) 831
BmsI GCATC 2 cut(s) 92, 334
BpuEI CTTGAG 2 cut(s) 112, 801
BsaI GGTCTC 1 cut(s) 421
BsaJI CCNNGG 1 cut(s) 656
BsaXI ACNNNNNCTCC 4 cut(s) 174, 204, 355, 385
Bsc4I CCNNNNNNNGG 1 cut(s) 668
Bse1I ACTGG 3 cut(s) 67, 632, 887
BseDI CCNNGG 1 cut(s) 656
BseGI GGATG 3 cut(s) 107, 530, 648
BseLI CCNNNNNNNGG 1 cut(s) 668
BseMII CTCAG 1 cut(s) 320
BseNI ACTGG 3 cut(s) 67, 632, 887
BseRI GAGGAG 2 cut(s) 702, 767
BseSI GKGCMC 1 cut(s) 486
BseXI GCAGC 3 cut(s) 26, 417, 709
Bsh1236I CGCG 1 cut(s) 829
BshFI GGCC 3 cut(s) 264, 661, 833
BsiHKAI GWGCWC 2 cut(s) 486, 639
BsiHKCI CYCGRG 1 cut(s) 638
BslI CCNNNNNNNGG 1 cut(s) 668
BsmAI GTCTC 3 cut(s) 25, 421, 522
BsmI GAATGC 1 cut(s) 603
BsnI GGCC 3 cut(s) 264, 661, 833
Bso31I GGTCTC 1 cut(s) 421
BsoBI CYCGRG 1 cut(s) 638
Bsp1286I GDGCHC 2 cut(s) 486, 639
Bsp143I GATC 2 cut(s) 559, 849
BspACI CCGC 1 cut(s) 829
BspANI GGCC 3 cut(s) 264, 661, 833
BspCNI CTCAG 1 cut(s) 321
BspFNI CGCG 1 cut(s) 829
BspHI TCATGA 1 cut(s) 274
BspTNI GGTCTC 1 cut(s) 421
BsrI ACTGG 3 cut(s) 67, 632, 887
BssECI CCNNGG 1 cut(s) 656
BssMI GATC 2 cut(s) 559, 849
BssNAI GTATAC 1 cut(s) 282
Bst1107I GTATAC 1 cut(s) 282
Bst4CI ACNGT 2 cut(s) 376, 551
BstAPI GCANNNNNTGC 1 cut(s) 468
BstC8I GCNNGC 4 cut(s) 83, 262, 460, 831
BstDEI CTNAG 2 cut(s) 329, 726
BstF5I GGATG 3 cut(s) 107, 530, 648
BstFNI CGCG 1 cut(s) 829
BstHHI GCGC 1 cut(s) 829
BstKTI GATC 2 cut(s) 562, 852
BstMAI GTCTC 3 cut(s) 25, 421, 522
BstMBI GATC 2 cut(s) 559, 849
BstMWI GCNNNNNNNGC 1 cut(s) 468
BstNSI RCATGY 1 cut(s) 508
BstSLI GKGCMC 1 cut(s) 486
BstUI CGCG 1 cut(s) 829
BstV1I GCAGC 3 cut(s) 26, 417, 709
BstZ17I GTATAC 1 cut(s) 282
BsuRI GGCC 3 cut(s) 264, 661, 833
BtsCI GGATG 3 cut(s) 107, 530, 648
BtsI GCAGTG 1 cut(s) 112
BtsIMutI CAGTG 3 cut(s) 112, 639, 880
Cac8I GCNNGC 4 cut(s) 83, 262, 460, 831
CciI TCATGA 1 cut(s) 274
CfoI GCGC 1 cut(s) 829
Cfr13I GGNCC 1 cut(s) 831
Csp6I GTAC 2 cut(s) 41, 372
CviAII CATG 6 cut(s) 275, 411, 505, 588, 674, 718
CviQI GTAC 2 cut(s) 41, 372
DdeI CTNAG 2 cut(s) 329, 726
DpnI GATC 2 cut(s) 561, 851
DpnII GATC 2 cut(s) 559, 849
EaeI YGGCCR 1 cut(s) 659
Eco31I GGTCTC 1 cut(s) 421
Eco88I CYCGRG 1 cut(s) 638
FaeI CATG 6 cut(s) 278, 414, 508, 591, 677, 721
FalI AAGNNNNNCTT 2 cut(s) 74, 106
FatI CATG 6 cut(s) 274, 410, 504, 587, 673, 717
FauI CCCGC 1 cut(s) 822
FblI GTMKAC 1 cut(s) 281
Fnu4HI GCNGC 3 cut(s) 15, 406, 723
FokI GGATG 3 cut(s) 114, 537, 635
Fsp4HI GCNGC 3 cut(s) 15, 406, 723
GlaI GCGC 1 cut(s) 828
GluI GCNGC 3 cut(s) 15, 406, 723
HaeIII GGCC 3 cut(s) 264, 661, 833
HhaI GCGC 1 cut(s) 829
Hin1II CATG 6 cut(s) 278, 414, 508, 591, 677, 721
Hin6I GCGC 1 cut(s) 827
HinP1I GCGC 1 cut(s) 827
HincII GTYRAC 1 cut(s) 583
HindII GTYRAC 1 cut(s) 583
HindIII AAGCTT 1 cut(s) 219
HinfI GANTC 5 cut(s) 131, 194, 325, 515, 584
HphI GGTGA 4 cut(s) 64, 239, 563, 767
Hpy166II GTNNAC 5 cut(s) 72, 282, 484, 583, 598
Hpy188I TCNGA 4 cut(s) 315, 330, 380, 524
Hpy188III TCNNGA 3 cut(s) 91, 275, 853
Hpy8I GTNNAC 5 cut(s) 72, 282, 484, 583, 598
HpyAV CCTTC 2 cut(s) 328, 662
HpyCH4III ACNGT 2 cut(s) 376, 551
HpyCH4V TGCA 8 cut(s) 105, 235, 260, 462, 471, 484, 530, 603
HpyF10VI GCNNNNNNNGC 1 cut(s) 468
HpyF3I CTNAG 2 cut(s) 329, 726
Hsp92II CATG 6 cut(s) 278, 414, 508, 591, 677, 721
HspAI GCGC 1 cut(s) 827
Kzo9I GATC 2 cut(s) 559, 849
Lsp1109I GCAGC 3 cut(s) 26, 417, 709
LweI GCATC 2 cut(s) 92, 334
MaeIII GTNAC 2 cut(s) 122, 551
MalI GATC 2 cut(s) 561, 851
MboI GATC 2 cut(s) 559, 849
MboII GAAGA 5 cut(s) 172, 635, 812, 815, 859
MhlI GDGCHC 2 cut(s) 486, 639
MluCI AATT 6 cut(s) 24, 32, 163, 173, 229, 872
MlyI GAGTC 3 cut(s) 140, 524, 578
MseI TTAA 1 cut(s) 537
Mva1269I GAATGC 1 cut(s) 603
MvnI CGCG 1 cut(s) 829
MwoI GCNNNNNNNGC 1 cut(s) 468
NdeII GATC 2 cut(s) 559, 849
NlaIII CATG 6 cut(s) 278, 414, 508, 591, 677, 721
NmeAIII GCCGAG 1 cut(s) 637
NmuCI GTSAC 1 cut(s) 551
NspI RCATGY 1 cut(s) 508
PaeR7I CTCGAG 1 cut(s) 638
PagI TCATGA 1 cut(s) 274
PciI ACATGT 1 cut(s) 504
PctI GAATGC 1 cut(s) 603
PfeI GAWTC 2 cut(s) 194, 325
PkrI GCNGC 3 cut(s) 16, 407, 724
PleI GAGTC 3 cut(s) 139, 523, 578
PpsI GAGTC 3 cut(s) 139, 523, 578
PscI ACATGT 1 cut(s) 504
PspPI GGNCC 1 cut(s) 831
PspXI VCTCGAGB 1 cut(s) 638
RsaI GTAC 2 cut(s) 42, 373
RsaNI GTAC 2 cut(s) 41, 372
SaqAI TTAA 1 cut(s) 537
SatI GCNGC 3 cut(s) 15, 406, 723
Sau3AI GATC 2 cut(s) 559, 849
Sau96I GGNCC 1 cut(s) 831
ScaI AGTACT 1 cut(s) 373
SchI GAGTC 3 cut(s) 140, 524, 578
SduI GDGCHC 2 cut(s) 486, 639
SfaNI GCATC 2 cut(s) 92, 334
Sfr274I CTCGAG 1 cut(s) 638
SlaI CTCGAG 1 cut(s) 638
SmlI CTYRAG 3 cut(s) 91, 638, 816
SmoI CTYRAG 3 cut(s) 91, 638, 816
Sse9I AATT 6 cut(s) 24, 32, 163, 173, 229, 872
SsiI CCGC 1 cut(s) 829
SspI AATATT 1 cut(s) 681
TaaI ACNGT 2 cut(s) 376, 551
TaqI TCGA 1 cut(s) 639
TasI AATT 6 cut(s) 24, 32, 163, 173, 229, 872
TatI WGTACW 1 cut(s) 371
TfiI GAWTC 2 cut(s) 194, 325
Tru1I TTAA 1 cut(s) 537
Tru9I TTAA 1 cut(s) 537
TscAI CASTG 3 cut(s) 112, 639, 887
TseFI GTSAC 1 cut(s) 551
TseI GCWGC 3 cut(s) 14, 405, 722
Tsp45I GTSAC 1 cut(s) 551
TspDTI ATGAA 6 cut(s) 186, 312, 465, 596, 706, 860
TspRI CASTG 3 cut(s) 112, 639, 887
VneI GTGCAC 1 cut(s) 482
XapI RAATTY 2 cut(s) 229, 872
XceI RCATGY 1 cut(s) 508
XhoI CTCGAG 1 cut(s) 638
XmiI GTMKAC 1 cut(s) 281
ZrmI AGTACT 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.