Rorug02G0561400

4Fe-4S single cluster domain of Ferredoxin I

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
68693788 .. 68695124
1337 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0561400.1

Sequence Viewer

Length: 249 bp
ATGGACCGTTCAAATCCTGCCACCTCAATCGTTGAAGGCTACTTGAAGGCTGAGGGTTTGTGTGGAATGGATGCGAATACTGAATGGAATATAATAGGTACATGGGATTTGCAAGCTTTATGTACAACCTGTATCCTAACAATAGAAATGGAGTTGGAGAAATGGTGTTTCTGTAGCTGTACTCAGACTGAAAGATTGAGTGGGCATCCTCTCTACCAAACCATTCCACTTCACCACCATCGAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.36

Weight (kDa)

5.4

Isoelectric Point (pI)

41.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 100, 124, 181
AgsI TTSAA 3 cut(s) 12, 35, 46
AluBI AGCT 2 cut(s) 116, 177
AluI AGCT 2 cut(s) 116, 177
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 224
AvaII GGWCC 1 cut(s) 4
BbvCI CCTCAGC 1 cut(s) 51
BccI CCATC 1 cut(s) 246
BciVI GTATCC 1 cut(s) 143
BfmI CTRYAG 1 cut(s) 172
BfuI GTATCC 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmsI GCATC 2 cut(s) 61, 214
Bpu10I CCTNAGC 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 149, 179
BseGI GGATG 2 cut(s) 76, 205
BseMII CTCAG 2 cut(s) 42, 197
Bsp1407I TGTACA 1 cut(s) 122
BspCNI CTCAG 2 cut(s) 43, 196
BsrGI TGTACA 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 8
BstAUI TGTACA 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 2 cut(s) 51, 183
BstF5I GGATG 2 cut(s) 76, 205
BstSFI CTRYAG 1 cut(s) 172
BsuI GTATCC 1 cut(s) 143
BtsCI GGATG 2 cut(s) 76, 205
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 3 cut(s) 99, 123, 180
CviAII CATG 1 cut(s) 102
CviJI RGCY 4 cut(s) 39, 50, 116, 177
CviKI_1 RGCY 4 cut(s) 39, 50, 116, 177
CviQI GTAC 3 cut(s) 99, 123, 180
DdeI CTNAG 2 cut(s) 51, 183
Eco47I GGWCC 1 cut(s) 4
FaeI CATG 1 cut(s) 105
FaiI YATR 3 cut(s) 92, 103, 121
FatI CATG 1 cut(s) 101
FokI GGATG 2 cut(s) 83, 192
Hin1II CATG 1 cut(s) 105
HindIII AAGCTT 1 cut(s) 114
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 186
HpyAV CCTTC 2 cut(s) 29, 40
HpyCH4III ACNGT 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 112
HpyF3I CTNAG 2 cut(s) 51, 183
Hsp92II CATG 1 cut(s) 105
LpnPI CCDG 2 cut(s) 30, 142
LweI GCATC 2 cut(s) 61, 214
MmeI TCCRAC 1 cut(s) 135
MnlI CCTC 3 cut(s) 34, 46, 219
NlaIII CATG 1 cut(s) 105
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 3 cut(s) 100, 124, 181
RsaNI GTAC 3 cut(s) 99, 123, 180
Sau96I GGNCC 1 cut(s) 4
SetI ASST 5 cut(s) 26, 100, 118, 131, 179
SfaNI GCATC 2 cut(s) 61, 214
SfcI CTRYAG 1 cut(s) 172
SgeI CNNG 5 cut(s) 29, 55, 114, 125, 141
SinI GGWCC 1 cut(s) 4
TaaI ACNGT 1 cut(s) 8
TaqI TCGA 1 cut(s) 241
TatI WGTACW 2 cut(s) 122, 179
VpaK11BI GGWCC 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.