Rmu_sc0010851.1_g000001

low molecular weight

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010851.1
Physical Location & Seq
Forward (+)
262 .. 2253
1992 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010851.1_g000001.1.cds

Sequence Viewer

Length: 741 bp
atgaaggcattgcacagtggagtgccaacccacctcaatttacgactttgccactccacccagccctccctaaaaccccaattacttgttcttcttccacacttcccatctctccaaaccccaacgtttcactcaacttccctcaaattcaccgcctctttctcatctgggtctgcaagaaaagcatcaatggctgcttctgccccctccacggaggcagagatcaaacccttctctgtcctctttgtgtgcttgggcaacatctgcagaagcccagctgccgaaggagtcttcacggacttggtcaagaaaaggggtctggaatccaagttcaagattgactctgctggcaccattaattaccatgagggaaatcaagcggacccaagaatgagggcagcggctaaaaggcgtgggattgagataacatctttgtccaggccaatcaagctgcctgattttcgagatttcgatgttattcttgcaatggacaagcaaaaccgagctgatattttggaggcatttaatcggtggaaatttagagaaccactgcctgaggatgcttataaaaaggtcaagttaatgtgttcttattgtaagaaacacgatgaaactgaagtgccggatccttattatggtggacctcaaggttttgagaaggttttagatttacttgaagatgcatgtgaatcattgttggacagcatattggctgagaacaagcatattttggattcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

246

Amino Acids

27.42

Weight (kDa)

8.46

Isoelectric Point (pI)

53.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015172)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G44620 AT3G44620
fragaria_vesca FvH4_3g24360 FvH4_3g24360 FvH4_3g24360
malus_domestica MD11G1159700.v1.1
prunus_persica Prupe.6G122700_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0043851
rosa_laevigata RLG00000034219
rosa_multiflora Rmu_sc0010851.1_g000001
rosa_roxburghii Rroxscaffold_1G00037200
rosa_rugosa Rorug05G0208900
rosa_samantha Rh5AG292800 Rh5CG328500 Rh5DG309800
rosa_wichuraiana Rw5G027150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 567
AccB1I GGYRCC 1 cut(s) 350
AciI CCGC 3 cut(s) 153, 380, 401
AclI AACGTT 1 cut(s) 125
AclWI GGATC 2 cut(s) 620, 633
AcsI RAATTY 2 cut(s) 146, 536
AcuI CTGAAG 1 cut(s) 636
AfiI CCNNNNNNNGG 2 cut(s) 211, 635
AgsI TTSAA 2 cut(s) 334, 677
AjnI CCWGG 1 cut(s) 437
AjuI GAANNNNNNNTTGG 2 cut(s) 72, 104
AloI GAACNNNNNNTCC 2 cut(s) 314, 346
AluBI AGCT 3 cut(s) 278, 451, 506
AluI AGCT 3 cut(s) 278, 451, 506
AlwI GGATC 2 cut(s) 620, 633
AoxI GGCC 1 cut(s) 440
ApeKI GCWGC 4 cut(s) 194, 278, 398, 451
ApoI RAATTY 2 cut(s) 146, 536
AseI ATTAAT 1 cut(s) 357
AspS9I GGNCC 2 cut(s) 382, 641
AsuHPI GGTGA 1 cut(s) 142
AvaII GGWCC 2 cut(s) 382, 641
AxyI CCTNAGG 1 cut(s) 555
BamHI GGATCC 1 cut(s) 625
BanI GGYRCC 1 cut(s) 350
BbsI GAAGAC 1 cut(s) 283
BbvI GCAGC 4 cut(s) 181, 265, 410, 438
BccI CCATC 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 439
BfmI CTRYAG 1 cut(s) 265
BisI GCNGC 5 cut(s) 195, 279, 399, 402, 452
BlsI GCNGC 5 cut(s) 196, 280, 400, 403, 453
Bme1390I CCNGG 1 cut(s) 439
Bme18I GGWCC 2 cut(s) 382, 641
BmgT120I GGNCC 2 cut(s) 382, 641
BmiI GGNNCC 3 cut(s) 352, 384, 627
BmrFI CCNGG 1 cut(s) 439
BmsI GCATC 3 cut(s) 194, 550, 670
BpiI GAAGAC 1 cut(s) 283
BpuEI CTTGAG 1 cut(s) 630
BsaJI CCNNGG 1 cut(s) 210
Bsc4I CCNNNNNNNGG 2 cut(s) 211, 635
Bse21I CCTNAGG 1 cut(s) 555
Bse3DI GCAATG 2 cut(s) 8, 492
BseBI CCWGG 1 cut(s) 439
BseDI CCNNGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 565
BseLI CCNNNNNNNGG 2 cut(s) 211, 635
BseMI GCAATG 2 cut(s) 8, 492
BseMII CTCAG 2 cut(s) 546, 705
BseXI GCAGC 4 cut(s) 181, 265, 410, 438
BseYI CCCAGC 2 cut(s) 60, 274
BshFI GGCC 1 cut(s) 442
BshNI GGYRCC 1 cut(s) 350
BsiSI CCGG 1 cut(s) 623
BslI CCNNNNNNNGG 2 cut(s) 211, 635
BsnI GGCC 1 cut(s) 442
Bsp143I GATC 2 cut(s) 222, 625
BspACI CCGC 3 cut(s) 153, 380, 401
BspANI GGCC 1 cut(s) 442
BspCNI CTCAG 2 cut(s) 547, 706
BspLI GGNNCC 3 cut(s) 352, 384, 627
BspMAI CTGCAG 1 cut(s) 269
BspPI GGATC 2 cut(s) 620, 633
BspT107I GGYRCC 1 cut(s) 350
BsrDI GCAATG 2 cut(s) 8, 492
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 2 cut(s) 222, 625
Bst2UI CCWGG 1 cut(s) 439
Bst4CI ACNGT 1 cut(s) 17
BstAPI GCANNNNNTGC 1 cut(s) 264
BstC8I GCNNGC 1 cut(s) 349
BstDEI CTNAG 2 cut(s) 555, 714
BstDSI CCRYGG 1 cut(s) 210
BstF5I GGATG 1 cut(s) 565
BstKTI GATC 2 cut(s) 225, 628
BstMBI GATC 2 cut(s) 222, 625
BstMWI GCNNNNNNNGC 5 cut(s) 182, 191, 200, 264, 448
BstNI CCWGG 1 cut(s) 439
BstNSI RCATGY 1 cut(s) 687
BstSCI CCNGG 1 cut(s) 437
BstSFI CTRYAG 1 cut(s) 265
BstV1I GCAGC 4 cut(s) 181, 265, 410, 438
BstV2I GAAGAC 1 cut(s) 283
BstX2I RGATCY 1 cut(s) 625
BstYI RGATCY 1 cut(s) 625
Bsu36I CCTNAGG 1 cut(s) 555
BsuRI GGCC 1 cut(s) 442
BtgI CCRYGG 1 cut(s) 210
BtsCI GGATG 1 cut(s) 565
BtsI GCAGTG 1 cut(s) 548
BtsIMutI CAGTG 2 cut(s) 22, 548
Cac8I GCNNGC 1 cut(s) 349
Cfr13I GGNCC 2 cut(s) 382, 641
CviAII CATG 2 cut(s) 365, 684
CviJI RGCY 9 cut(s) 64, 194, 273, 278, 404, 442, 451, 506, 713
CviKI_1 RGCY 9 cut(s) 64, 194, 273, 278, 404, 442, 451, 506, 713
DdeI CTNAG 2 cut(s) 555, 714
DpnI GATC 2 cut(s) 224, 627
DpnII GATC 2 cut(s) 222, 625
Eco47I GGWCC 2 cut(s) 382, 641
Eco57I CTGAAG 1 cut(s) 636
Eco81I CCTNAGG 1 cut(s) 555
EcoRII CCWGG 1 cut(s) 437
EcoT22I ATGCAT 1 cut(s) 685
FaeI CATG 2 cut(s) 368, 687
FaiI YATR 6 cut(s) 366, 567, 636, 685, 707, 726
FatI CATG 2 cut(s) 364, 683
Fnu4HI GCNGC 5 cut(s) 195, 279, 399, 402, 452
FokI GGATG 1 cut(s) 572
Fsp4HI GCNGC 5 cut(s) 195, 279, 399, 402, 452
GluI GCNGC 5 cut(s) 195, 279, 399, 402, 452
GsaI CCCAGC 2 cut(s) 64, 278
HaeIII GGCC 1 cut(s) 442
HapII CCGG 1 cut(s) 623
Hin1II CATG 2 cut(s) 368, 687
HinfI GANTC 5 cut(s) 288, 323, 341, 689, 734
HpaII CCGG 1 cut(s) 623
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 641
Hpy188III TCNNGA 4 cut(s) 307, 320, 334, 464
Hpy8I GTNNAC 1 cut(s) 641
HpyAV CCTTC 3 cut(s) 241, 278, 652
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4IV ACGT 1 cut(s) 125
HpyCH4V TGCA 5 cut(s) 13, 176, 267, 485, 683
HpyF10VI GCNNNNNNNGC 5 cut(s) 182, 191, 200, 264, 448
HpyF3I CTNAG 2 cut(s) 555, 714
HpySE526I ACGT 1 cut(s) 125
Hsp92II CATG 2 cut(s) 368, 687
Kzo9I GATC 2 cut(s) 222, 625
Lsp1109I GCAGC 4 cut(s) 181, 265, 410, 438
LweI GCATC 3 cut(s) 194, 550, 670
MaeII ACGT 1 cut(s) 125
MalI GATC 2 cut(s) 224, 627
MboI GATC 2 cut(s) 222, 625
MboII GAAGA 4 cut(s) 83, 86, 283, 689
MflI RGATCY 1 cut(s) 625
MluCI AATT 5 cut(s) 37, 80, 146, 358, 536
MlyI GAGTC 2 cut(s) 297, 335
MmeI TCCRAC 1 cut(s) 678
Mph1103I ATGCAT 1 cut(s) 685
MseI TTAA 4 cut(s) 357, 525, 581, 739
MspA1I CMGCKG 2 cut(s) 278, 401
MspI CCGG 1 cut(s) 623
MspR9I CCNGG 1 cut(s) 439
MvaI CCWGG 1 cut(s) 439
MwoI GCNNNNNNNGC 5 cut(s) 182, 191, 200, 264, 448
NdeII GATC 2 cut(s) 222, 625
NlaIII CATG 2 cut(s) 368, 687
NlaIV GGNNCC 3 cut(s) 352, 384, 627
NsiI ATGCAT 1 cut(s) 685
NspI RCATGY 1 cut(s) 687
PfeI GAWTC 3 cut(s) 323, 689, 734
PflFI GACNNNGTC 1 cut(s) 302
PkrI GCNGC 5 cut(s) 196, 280, 400, 403, 453
PleI GAGTC 2 cut(s) 296, 335
PpsI GAGTC 2 cut(s) 296, 335
PshBI ATTAAT 1 cut(s) 357
PsiI TTATAA 1 cut(s) 567
Psp1406I AACGTT 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 437
PspFI CCCAGC 2 cut(s) 60, 274
PspGI CCWGG 1 cut(s) 437
PspN4I GGNNCC 3 cut(s) 352, 384, 627
PspPI GGNCC 2 cut(s) 382, 641
PstI CTGCAG 1 cut(s) 269
PsuI RGATCY 1 cut(s) 625
PsyI GACNNNGTC 1 cut(s) 302
PvuII CAGCTG 1 cut(s) 278
SaqAI TTAA 4 cut(s) 357, 525, 581, 739
SatI GCNGC 5 cut(s) 195, 279, 399, 402, 452
Sau3AI GATC 2 cut(s) 222, 625
Sau96I GGNCC 2 cut(s) 382, 641
SchI GAGTC 2 cut(s) 297, 335
ScrFI CCNGG 1 cut(s) 439
SetI ASST 9 cut(s) 36, 128, 280, 453, 508, 576, 646, 652, 663
SfaNI GCATC 3 cut(s) 194, 550, 670
SfcI CTRYAG 1 cut(s) 265
SinI GGWCC 2 cut(s) 382, 641
SmlI CTYRAG 1 cut(s) 645
SmoI CTYRAG 1 cut(s) 645
Sse9I AATT 5 cut(s) 37, 80, 146, 358, 536
SsiI CCGC 3 cut(s) 153, 380, 401
StyD4I CCNGG 1 cut(s) 437
TaaI ACNGT 1 cut(s) 17
TaiI ACGT 1 cut(s) 128
TaqI TCGA 2 cut(s) 463, 471
TasI AATT 5 cut(s) 37, 80, 146, 358, 536
TauI GCSGC 1 cut(s) 404
TfiI GAWTC 3 cut(s) 323, 689, 734
Tru1I TTAA 4 cut(s) 357, 525, 581, 739
Tru9I TTAA 4 cut(s) 357, 525, 581, 739
TscAI CASTG 2 cut(s) 22, 555
TseI GCWGC 4 cut(s) 194, 278, 398, 451
TspDTI ATGAA 2 cut(s) 17, 624
TspGWI ACGGA 2 cut(s) 227, 311
TspRI CASTG 2 cut(s) 22, 555
Tth111I GACNNNGTC 1 cut(s) 302
VpaK11BI GGWCC 2 cut(s) 382, 641
VspI ATTAAT 1 cut(s) 357
XapI RAATTY 2 cut(s) 146, 536
XceI RCATGY 1 cut(s) 687
Zsp2I ATGCAT 1 cut(s) 685
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.