Rmu_sc0013777.1_g000008

Double-stranded RNA binding motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013777.1
OG0016795
Physical Location & Seq
Forward (+)
33756 .. 35621
1866 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013777.1_g000008.1.cds

Sequence Viewer

Length: 1005 bp
atgatgtacaagagtaagctgcaggagctgtgccatgaaaagaaatggggtttgccaagatacactgccatgaaagatggaccggatcacaatccttgcttcaaggcttgtgtctcagtaaatggctactcctttgactcgccggttacttgtaaatctttcaaacaagcccagaaccaagctgccatggtcgcttttcttcacttcacctctccaccttcttcttcttcttcttcaccttcaccggttcttgaagttgggtttaaggctagtactgttacagtggatgagcatagcacctcggagagcccagagttcaacactactagtactttaaagaaggcagagaatgctgcttctatgtctatttcattctcagacgggtttcaggatgacgaacctggtcgtctttacaagaatctcttacaggagttggctcagagagaaggtttttccatgccagcatatacaactgtgaactcgggtgcatttcacatgccaacattctattccactgtggatgtggaaggagagaaattctccggacatgtggggaaatccaaaaaacaggcagaattgagtgctgcgaaggttgcttacaccaccttaaaagagcagatcgatgaagttaaagggtcagacaatgtagtggacaacatcaatctcaaagctgtgtactgtaatgcacctgatgcaatggtactggaaatcgataatatgaataaaactggaaagccttcctcatgcttggaaccagtgctctcttcaactaaagaatacccttcctctccagcatttatgcatactgatctttcggctatctcaattgcggataaaaatgaagggaaattaacgggattgaaaagttacttgctgtgcaacaggtttagagtctacacacattttccagatattgcattccccaagtgcataactgtgctgcccatcagtgatgacaaatgggtggctgtcaggttggagttcccaaatgaagaaagcaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
dsrm

Protein Analysis

334

Amino Acids

36.78

Weight (kDa)

5.8

Isoelectric Point (pI)

43.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016795)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g27052
malus_domestica MD11G1178800.v1.1
prunus_persica Prupe.6G151600_v2.0.a1 Prupe.6G151600_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0049631
rosa_laevigata RLG00000034628
rosa_multiflora Rmu_sc0013777.1_g000008
rosa_roxburghii Rroxscaffold_1G00032040
rosa_rugosa Rorug05G0249300
rosa_samantha Rh5AG325800 Rh5BG337100 Rh5CG361800 Rh5DG349300
rosa_wichuraiana Rw5G030790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 894
AccIII TCCGGA 1 cut(s) 542
AciI CCGC 1 cut(s) 830
AclWI GGATC 1 cut(s) 93
AcsI RAATTY 1 cut(s) 536
AfaI GTAC 5 cut(s) 8, 274, 331, 677, 702
AflIII ACRYGT 1 cut(s) 547
AgeI ACCGGT 1 cut(s) 244
AgsI TTSAA 6 cut(s) 103, 163, 254, 319, 768, 862
AhlI ACTAGT 1 cut(s) 326
AjnI CCWGG 1 cut(s) 400
AjuI GAANNNNNNNTTGG 2 cut(s) 493, 525
AluBI AGCT 4 cut(s) 19, 28, 182, 671
AluI AGCT 4 cut(s) 19, 28, 182, 671
Alw21I GWGCWC 1 cut(s) 762
Alw26I GTCTC 1 cut(s) 118
AlwI GGATC 1 cut(s) 93
AlwNI CAGNNNCTG 1 cut(s) 28
Ama87I CYCGRG 1 cut(s) 481
Aor13HI TCCGGA 1 cut(s) 542
ApeKI GCWGC 5 cut(s) 19, 182, 353, 584, 940
ApoI RAATTY 1 cut(s) 536
AsiGI ACCGGT 1 cut(s) 244
Asp700I GAANNNNTTC 1 cut(s) 736
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 3 cut(s) 199, 228, 234
AvaI CYCGRG 1 cut(s) 481
AvaII GGWCC 1 cut(s) 80
BanII GRGCYC 1 cut(s) 311
BarI GAAGNNNNNNTAC 2 cut(s) 581, 613
Bbv12I GWGCWC 1 cut(s) 762
BbvI GCAGC 5 cut(s) 6, 169, 340, 571, 927
BccI CCATC 2 cut(s) 71, 953
BciT130I CCWGG 1 cut(s) 402
BcoDI GTCTC 1 cut(s) 118
BcuI ACTAGT 1 cut(s) 326
BfaI CTAG 2 cut(s) 270, 327
BfmI CTRYAG 1 cut(s) 20
BisI GCNGC 5 cut(s) 20, 183, 354, 585, 941
BlsI GCNGC 5 cut(s) 21, 184, 355, 586, 942
BmcAI AGTACT 2 cut(s) 274, 331
Bme1390I CCNGG 1 cut(s) 402
Bme18I GGWCC 1 cut(s) 80
BmeT110I CYCGRG 1 cut(s) 481
BmgT120I GGNCC 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 753
BmrFI CCNGG 1 cut(s) 402
BmsI GCATC 1 cut(s) 682
BplI GAGNNNNNCTC 2 cut(s) 524, 556
BpmI CTGGAG 1 cut(s) 774
Bsa29I ATCGAT 2 cut(s) 621, 711
BsaBI GATNNNNATC 1 cut(s) 90
BsaJI CCNNGG 2 cut(s) 186, 300
BsaWI WCCGGW 3 cut(s) 82, 244, 542
Bse118I RCCGGY 2 cut(s) 142, 244
Bse1I ACTGG 3 cut(s) 708, 733, 755
Bse3DI GCAATG 1 cut(s) 702
Bse8I GATNNNNATC 1 cut(s) 90
BseAI TCCGGA 1 cut(s) 542
BseBI CCWGG 1 cut(s) 402
BseCI ATCGAT 2 cut(s) 621, 711
BseDI CCNNGG 2 cut(s) 186, 300
BseGI GGATG 3 cut(s) 292, 397, 526
BseJI GATNNNNATC 1 cut(s) 90
BseMI GCAATG 1 cut(s) 702
BseMII CTCAG 3 cut(s) 129, 390, 452
BseNI ACTGG 3 cut(s) 708, 733, 755
BseXI GCAGC 5 cut(s) 6, 169, 340, 571, 927
BshTI ACCGGT 1 cut(s) 244
BshVI ATCGAT 2 cut(s) 621, 711
BsiHKAI GWGCWC 1 cut(s) 762
BsiHKCI CYCGRG 1 cut(s) 481
BsiSI CCGG 4 cut(s) 83, 143, 245, 543
BsmAI GTCTC 1 cut(s) 118
BsmI GAATGC 2 cut(s) 355, 917
BsoBI CYCGRG 1 cut(s) 481
Bsp1286I GDGCHC 2 cut(s) 311, 762
Bsp13I TCCGGA 1 cut(s) 542
Bsp1407I TGTACA 1 cut(s) 6
Bsp143I GATC 3 cut(s) 85, 618, 808
Bsp19I CCATGG 1 cut(s) 186
BspACI CCGC 1 cut(s) 830
BspCNI CTCAG 3 cut(s) 128, 389, 451
BspDI ATCGAT 2 cut(s) 621, 711
BspEI TCCGGA 1 cut(s) 542
BspLI GGNNCC 1 cut(s) 753
BspMAI CTGCAG 1 cut(s) 24
BspPI GGATC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 702
BsrFI RCCGGY 2 cut(s) 142, 244
BsrGI TGTACA 1 cut(s) 6
BsrI ACTGG 3 cut(s) 708, 733, 755
BssAI RCCGGY 2 cut(s) 142, 244
BssECI CCNNGG 2 cut(s) 186, 300
BssMI GATC 3 cut(s) 85, 618, 808
BssT1I CCWWGG 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 402
Bst4CI ACNGT 6 cut(s) 277, 283, 475, 517, 680, 937
Bst6I CTCTTC 1 cut(s) 769
BstAPI GCANNNNNTGC 2 cut(s) 350, 692
BstAUI TGTACA 1 cut(s) 6
BstC8I GCNNGC 1 cut(s) 462
BstDEI CTNAG 3 cut(s) 115, 376, 438
BstDSI CCRYGG 1 cut(s) 186
BstF5I GGATG 3 cut(s) 292, 397, 526
BstKTI GATC 3 cut(s) 88, 621, 811
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 3 cut(s) 85, 618, 808
BstMWI GCNNNNNNNGC 5 cut(s) 25, 191, 350, 593, 692
BstNI CCWGG 1 cut(s) 402
BstNSI RCATGY 2 cut(s) 499, 551
BstSCI CCNGG 1 cut(s) 400
BstSFI CTRYAG 1 cut(s) 20
BstV1I GCAGC 5 cut(s) 6, 169, 340, 571, 927
Bsu15I ATCGAT 2 cut(s) 621, 711
BsuTUI ATCGAT 2 cut(s) 621, 711
BtgI CCRYGG 1 cut(s) 186
BtsCI GGATG 3 cut(s) 292, 397, 526
BtsI GCAGTG 1 cut(s) 63
BtsIMutI CAGTG 5 cut(s) 63, 288, 513, 762, 955
Cac8I GCNNGC 1 cut(s) 462
CaiI CAGNNNCTG 1 cut(s) 28
Cfr10I RCCGGY 2 cut(s) 142, 244
Cfr13I GGNCC 1 cut(s) 80
ClaI ATCGAT 2 cut(s) 621, 711
CsiI ACCWGGT 1 cut(s) 400
Csp6I GTAC 5 cut(s) 7, 273, 330, 676, 701
CspAI ACCGGT 1 cut(s) 244
CviAII CATG 7 cut(s) 35, 70, 187, 457, 496, 548, 744
CviQI GTAC 5 cut(s) 7, 273, 330, 676, 701
DdeI CTNAG 3 cut(s) 115, 376, 438
DpnI GATC 3 cut(s) 87, 620, 810
DpnII GATC 3 cut(s) 85, 618, 808
DraI TTTAAA 1 cut(s) 336
Eam1104I CTCTTC 1 cut(s) 769
EarI CTCTTC 1 cut(s) 769
Eco130I CCWWGG 1 cut(s) 186
Eco24I GRGCYC 1 cut(s) 311
Eco47I GGWCC 1 cut(s) 80
Eco88I CYCGRG 1 cut(s) 481
EcoRII CCWGG 1 cut(s) 400
EcoT14I CCWWGG 1 cut(s) 186
EcoT22I ATGCAT 1 cut(s) 804
EcoT38I GRGCYC 1 cut(s) 311
ErhI CCWWGG 1 cut(s) 186
FaeI CATG 7 cut(s) 38, 73, 190, 460, 499, 551, 747
FalI AAGNNNNNCTT 2 cut(s) 407, 439
FatI CATG 7 cut(s) 34, 69, 186, 456, 495, 547, 743
FblI GTMKAC 1 cut(s) 894
Fnu4HI GCNGC 5 cut(s) 20, 183, 354, 585, 941
FokI GGATG 3 cut(s) 299, 404, 533
FriOI GRGCYC 1 cut(s) 311
Fsp4HI GCNGC 5 cut(s) 20, 183, 354, 585, 941
FspBI CTAG 2 cut(s) 270, 327
GluI GCNGC 5 cut(s) 20, 183, 354, 585, 941
GsuI CTGGAG 1 cut(s) 774
HapII CCGG 4 cut(s) 83, 143, 245, 543
Hin1II CATG 7 cut(s) 38, 73, 190, 460, 499, 551, 747
HinfI GANTC 3 cut(s) 137, 418, 891
HpaII CCGG 4 cut(s) 83, 143, 245, 543
HphI GGTGA 3 cut(s) 199, 228, 234
Hpy166II GTNNAC 4 cut(s) 478, 652, 676, 895
Hpy188I TCNGA 4 cut(s) 304, 379, 441, 640
Hpy188III TCNNGA 4 cut(s) 251, 389, 543, 908
Hpy8I GTNNAC 4 cut(s) 478, 652, 676, 895
HpyAV CCTTC 9 cut(s) 228, 249, 334, 440, 521, 583, 747, 792, 836
HpyCH4III ACNGT 6 cut(s) 277, 283, 475, 517, 680, 937
HpyCH4V TGCA 8 cut(s) 22, 488, 686, 695, 802, 879, 917, 930
HpyF10VI GCNNNNNNNGC 5 cut(s) 25, 191, 350, 593, 692
HpyF3I CTNAG 3 cut(s) 115, 376, 438
Hsp92II CATG 7 cut(s) 38, 73, 190, 460, 499, 551, 747
Kpn2I TCCGGA 1 cut(s) 542
Kzo9I GATC 3 cut(s) 85, 618, 808
LmnI GCTCC 1 cut(s) 25
Lsp1109I GCAGC 5 cut(s) 6, 169, 340, 571, 927
LweI GCATC 1 cut(s) 682
MabI ACCWGGT 1 cut(s) 400
MaeI CTAG 2 cut(s) 270, 327
MaeIII GTNAC 3 cut(s) 145, 277, 866
MalI GATC 3 cut(s) 87, 620, 810
MboI GATC 3 cut(s) 85, 618, 808
MboII GAAGA 8 cut(s) 191, 213, 216, 219, 222, 225, 756, 1004
MfeI CAATTG 1 cut(s) 825
MhlI GDGCHC 2 cut(s) 311, 762
MluCI AATT 5 cut(s) 536, 575, 825, 848, 1000
MlyI GAGTC 2 cut(s) 131, 900
MmeI TCCRAC 1 cut(s) 957
MnlI CCTC 4 cut(s) 220, 310, 751, 796
Mph1103I ATGCAT 1 cut(s) 804
MroI TCCGGA 1 cut(s) 542
MroXI GAANNNNTTC 1 cut(s) 736
MseI TTAA 5 cut(s) 264, 335, 608, 630, 851
MslI CAYNNNNRTG 2 cut(s) 68, 935
MspI CCGG 4 cut(s) 83, 143, 245, 543
MspR9I CCNGG 1 cut(s) 402
MunI CAATTG 1 cut(s) 825
Mva1269I GAATGC 2 cut(s) 355, 917
MvaI CCWGG 1 cut(s) 402
MwoI GCNNNNNNNGC 5 cut(s) 25, 191, 350, 593, 692
NcoI CCATGG 1 cut(s) 186
NdeII GATC 3 cut(s) 85, 618, 808
NlaIII CATG 7 cut(s) 38, 73, 190, 460, 499, 551, 747
NlaIV GGNNCC 1 cut(s) 753
NsiI ATGCAT 1 cut(s) 804
NspI RCATGY 2 cut(s) 499, 551
PciI ACATGT 1 cut(s) 547
PctI GAATGC 2 cut(s) 355, 917
PdmI GAANNNNTTC 1 cut(s) 736
PfeI GAWTC 1 cut(s) 418
PinAI ACCGGT 1 cut(s) 244
PkrI GCNGC 5 cut(s) 21, 184, 355, 586, 942
PleI GAGTC 2 cut(s) 131, 899
PpsI GAGTC 2 cut(s) 131, 899
PscI ACATGT 1 cut(s) 547
Psp6I CCWGG 1 cut(s) 400
PspGI CCWGG 1 cut(s) 400
PspN4I GGNNCC 1 cut(s) 753
PspPI GGNCC 1 cut(s) 80
PstI CTGCAG 1 cut(s) 24
PstNI CAGNNNCTG 1 cut(s) 28
RsaI GTAC 5 cut(s) 8, 274, 331, 677, 702
RsaNI GTAC 5 cut(s) 7, 273, 330, 676, 701
RseI CAYNNNNRTG 2 cut(s) 68, 935
SaqAI TTAA 5 cut(s) 264, 335, 608, 630, 851
SatI GCNGC 5 cut(s) 20, 183, 354, 585, 941
Sau3AI GATC 3 cut(s) 85, 618, 808
Sau96I GGNCC 1 cut(s) 80
ScaI AGTACT 2 cut(s) 274, 331
SchI GAGTC 2 cut(s) 131, 900
ScrFI CCNGG 1 cut(s) 402
SduI GDGCHC 2 cut(s) 311, 762
SexAI ACCWGGT 1 cut(s) 400
SfaNI GCATC 1 cut(s) 682
SfcI CTRYAG 1 cut(s) 20
SinI GGWCC 1 cut(s) 80
SmiMI CAYNNNNRTG 2 cut(s) 68, 935
SpeI ACTAGT 1 cut(s) 326
Sse9I AATT 5 cut(s) 536, 575, 825, 848, 1000
SsiI CCGC 1 cut(s) 830
SspMI CTAG 2 cut(s) 270, 327
StyD4I CCNGG 1 cut(s) 400
StyI CCWWGG 1 cut(s) 186
TaaI ACNGT 6 cut(s) 277, 283, 475, 517, 680, 937
TaqI TCGA 2 cut(s) 621, 711
TasI AATT 5 cut(s) 536, 575, 825, 848, 1000
TatI WGTACW 4 cut(s) 6, 272, 329, 675
TfiI GAWTC 1 cut(s) 418
Tru1I TTAA 5 cut(s) 264, 335, 608, 630, 851
Tru9I TTAA 5 cut(s) 264, 335, 608, 630, 851
TscAI CASTG 5 cut(s) 70, 288, 520, 762, 955
TseI GCWGC 5 cut(s) 19, 182, 353, 584, 940
TspDTI ATGAA 7 cut(s) 51, 86, 360, 639, 734, 855, 1005
TspRI CASTG 5 cut(s) 70, 288, 520, 762, 955
VpaK11BI GGWCC 1 cut(s) 80
XapI RAATTY 1 cut(s) 536
XceI RCATGY 2 cut(s) 499, 551
XcmI CCANNNNNNNNNTGG 1 cut(s) 520
XmiI GTMKAC 1 cut(s) 894
XmnI GAANNNNTTC 1 cut(s) 736
XspI CTAG 2 cut(s) 270, 327
ZrmI AGTACT 2 cut(s) 274, 331
Zsp2I ATGCAT 1 cut(s) 804
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.