Rmu_sc0014047.1_g000001

Uncharacterized ACR, COG1399

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014047.1
Physical Location & Seq
Reverse (-)
1 .. 680
680 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014047.1_g000001.1.cds

Sequence Viewer

Length: 380 bp
atgtccactgtgatcaattgcgcaaaacccaattttcaatccttcactgatgaggacacagtttttcttgatttgggtgatcaaggaaatgaagatggtgaagatatagattcaccctgggaaggggctgttatttacaagagaaacgcttcgataacacatgttgagtactgtacaacattagagaggcttggcttgggaaacctttctacagaggtctccaaatctagggcttcggtgatggggttacgggtcactaaagctgtgaaggattatccaaatggcacaccagttcagatctctattgacatcacaaggaggaagcagaagttgaggcttgatgggatcatcaaaactgttatcacattgacttgcaacag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

13.94

Weight (kDa)

5.37

Isoelectric Point (pI)

36.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014617)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G19810 AT3G19810
fragaria_vesca FvH4_7g19250
malus_domestica MD01G1107600.v1.1
prunus_persica Prupe.2G212300_v2.0.a1
pyrus_communis pycom01g13450
rosa_chinensis RchiOBHm_Chr1g0363071
rosa_laevigata RLG00000027596
rosa_multiflora Rmu_sc0014047.1_g000001
rosa_roxburghii Rroxscaffold_4G00293490
rosa_rugosa Rorug01G0304300 Rorug01G0304400
rosa_samantha Rh1AG313400 Rh1BG276500 Rh1CG293300 Rh1DG307200
rosa_wichuraiana Rw1G027760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 22
AclWI GGATC 1 cut(s) 353
AfaI GTAC 2 cut(s) 170, 175
AfiI CCNNNNNNNGG 3 cut(s) 122, 123, 228
AflIII ACRYGT 1 cut(s) 160
AgsI TTSAA 1 cut(s) 38
AjnI CCWGG 1 cut(s) 116
AluBI AGCT 1 cut(s) 263
AluI AGCT 1 cut(s) 263
Alw26I GTCTC 1 cut(s) 223
AlwI GGATC 1 cut(s) 353
Asp700I GAANNNNTTC 2 cut(s) 148, 205
AspLEI GCGC 1 cut(s) 23
AsuHPI GGTGA 4 cut(s) 89, 105, 110, 250
BccI CCATC 3 cut(s) 89, 235, 335
BciT130I CCWGG 1 cut(s) 118
BclI TGATCA 2 cut(s) 12, 79
BcoDI GTCTC 1 cut(s) 223
BfaI CTAG 1 cut(s) 228
BfmI CTRYAG 1 cut(s) 210
BglII AGATCT 1 cut(s) 297
BmcAI AGTACT 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 118
BmrFI CCNGG 1 cut(s) 118
BsaI GGTCTC 1 cut(s) 223
BsaJI CCNNGG 2 cut(s) 116, 117
Bsc4I CCNNNNNNNGG 3 cut(s) 122, 123, 228
Bse1I ACTGG 1 cut(s) 290
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 2 cut(s) 116, 117
BseLI CCNNNNNNNGG 3 cut(s) 122, 123, 228
BseNI ACTGG 1 cut(s) 290
BslI CCNNNNNNNGG 3 cut(s) 122, 123, 228
BsmAI GTCTC 1 cut(s) 223
Bso31I GGTCTC 1 cut(s) 223
Bsp1407I TGTACA 1 cut(s) 173
Bsp143I GATC 4 cut(s) 12, 79, 297, 345
BspPI GGATC 1 cut(s) 353
BspTNI GGTCTC 1 cut(s) 223
BsrGI TGTACA 1 cut(s) 173
BsrI ACTGG 1 cut(s) 290
BssECI CCNNGG 2 cut(s) 116, 117
BssMI GATC 4 cut(s) 12, 79, 297, 345
Bst2UI CCWGG 1 cut(s) 118
Bst4CI ACNGT 4 cut(s) 10, 61, 173, 358
BstAUI TGTACA 1 cut(s) 173
BstHHI GCGC 1 cut(s) 23
BstKTI GATC 4 cut(s) 15, 82, 300, 348
BstMAI GTCTC 1 cut(s) 223
BstMBI GATC 4 cut(s) 12, 79, 297, 345
BstNI CCWGG 1 cut(s) 118
BstNSI RCATGY 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 297
BstYI RGATCY 1 cut(s) 297
BtsIMutI CAGTG 2 cut(s) 6, 45
CfoI GCGC 1 cut(s) 23
Csp6I GTAC 2 cut(s) 169, 174
CviAII CATG 1 cut(s) 161
CviJI RGCY 6 cut(s) 128, 190, 195, 233, 263, 337
CviKI_1 RGCY 6 cut(s) 128, 190, 195, 233, 263, 337
CviQI GTAC 2 cut(s) 169, 174
DpnI GATC 4 cut(s) 14, 81, 299, 347
DpnII GATC 4 cut(s) 12, 79, 297, 345
Eco31I GGTCTC 1 cut(s) 223
EcoRII CCWGG 1 cut(s) 116
FaeI CATG 1 cut(s) 164
FaiI YATR 2 cut(s) 107, 162
FatI CATG 1 cut(s) 160
FbaI TGATCA 2 cut(s) 12, 79
FspBI CTAG 1 cut(s) 228
FspI TGCGCA 1 cut(s) 22
GlaI GCGC 1 cut(s) 22
HhaI GCGC 1 cut(s) 23
Hin1II CATG 1 cut(s) 164
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HinfI GANTC 1 cut(s) 110
HphI GGTGA 4 cut(s) 89, 105, 110, 250
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 297
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 3 cut(s) 52, 116, 262
HpyCH4III ACNGT 4 cut(s) 10, 61, 173, 358
HpyCH4V TGCA 1 cut(s) 375
Hsp92II CATG 1 cut(s) 164
HspAI GCGC 1 cut(s) 21
Ksp22I TGATCA 2 cut(s) 12, 79
Kzo9I GATC 4 cut(s) 12, 79, 297, 345
LpnPI CCDG 3 cut(s) 103, 130, 303
MaeI CTAG 1 cut(s) 228
MaeIII GTNAC 2 cut(s) 246, 253
MalI GATC 4 cut(s) 14, 81, 299, 347
MboI GATC 4 cut(s) 12, 79, 297, 345
MboII GAAGA 2 cut(s) 104, 113
MfeI CAATTG 1 cut(s) 16
MflI RGATCY 1 cut(s) 297
MluCI AATT 2 cut(s) 16, 31
MnlI CCTC 5 cut(s) 46, 180, 208, 312, 327
MroXI GAANNNNTTC 2 cut(s) 148, 205
MspR9I CCNGG 1 cut(s) 118
MunI CAATTG 1 cut(s) 16
MvaI CCWGG 1 cut(s) 118
NdeII GATC 4 cut(s) 12, 79, 297, 345
NlaIII CATG 1 cut(s) 164
NmuCI GTSAC 1 cut(s) 253
NsbI TGCGCA 1 cut(s) 22
NspI RCATGY 1 cut(s) 164
PasI CCCWGGG 1 cut(s) 117
PciI ACATGT 1 cut(s) 160
PdmI GAANNNNTTC 2 cut(s) 148, 205
PfeI GAWTC 1 cut(s) 110
PscI ACATGT 1 cut(s) 160
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PsuI RGATCY 1 cut(s) 297
RsaI GTAC 2 cut(s) 170, 175
RsaNI GTAC 2 cut(s) 169, 174
Sau3AI GATC 4 cut(s) 12, 79, 297, 345
ScaI AGTACT 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 118
SetI ASST 3 cut(s) 207, 219, 265
SfcI CTRYAG 1 cut(s) 210
Sse9I AATT 2 cut(s) 16, 31
SspMI CTAG 1 cut(s) 228
StyD4I CCNGG 1 cut(s) 116
TaaI ACNGT 4 cut(s) 10, 61, 173, 358
TaqI TCGA 1 cut(s) 152
TasI AATT 2 cut(s) 16, 31
TatI WGTACW 2 cut(s) 168, 173
TfiI GAWTC 1 cut(s) 110
TscAI CASTG 2 cut(s) 13, 52
TseFI GTSAC 1 cut(s) 253
Tsp45I GTSAC 1 cut(s) 253
TspDTI ATGAA 1 cut(s) 105
TspRI CASTG 2 cut(s) 13, 52
XceI RCATGY 1 cut(s) 164
XmnI GAANNNNTTC 2 cut(s) 148, 205
XspI CTAG 1 cut(s) 228
ZrmI AGTACT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.