Rmu_sc0019383.1_g000003

Nucleotide-diphospho-sugar transferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019383.1
OG0015842
Physical Location & Seq
Forward (+)
17216 .. 19359
2144 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019383.1_g000003.1.cds

Sequence Viewer

Length: 1137 bp
atgctttcacaccggaggcgactaccggcgactttaggcagccgtgattccagcagagccgccgacatgttgccggaatccgtcgcactcttccggcggttcctcttcttcctcaccgtgtttctatcgtgcttgctcctctacaaaaactccgataccctccgccttcttcatcacttctcttcttatccctctgcttccttcaccgccttcaattcctcgccggtcagtgaggaacgagggattgaagaggttttgaaggatgctgctatggaagacgggacggtgattttgacgacgttaaatgaagcatgggcggctccaaattcgatcattgatctcttccttgagagctttaggaatggaattggcactcataggctcttgaatcatttggttatcgttgccttggaccaaaaggcatatcagcgttgtttggaggtacacactcattgctttgctcttcttactgagggagtagattttcatatggaggcatacttcatgaccccccagtacttgaagatgatgtgggcaaggattgattttctccgttctgttcttgagatgggctacaattttgtcttcacggatgctgatgttatgtggttcaggaatccttttccgcggttttattcggatgcagattttcagattgcttgcgatcatttcttaggcagctccgatgatttgcagaacagacctaatggaggattcaactatgtgaagtccaataaccggtcaatagagttctacaaatattggtattcttctcgtgaaacctaccctggataccatgatcaggatgttctcaatatgatcaagtttgatccctccactgttaatattggactgaaaatgaaatttctggacactgcttattttggtggattttgtgaacctagtagagatttgaatcaagtttgcacgatgcatgcaaattgttgttttggtctagatagcaagctgcatgaccttagaattatggttcaggactggaaggagtttctgtccttgccaccaagtttgaagagaactttgatatttccatgggcggttccgcagaattgcagccttgattctctccgtcgctatgatataccggagagtgaccctcaacatggtttgcaagaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Nucleotid_trans

Protein Analysis

378

Amino Acids

43.79

Weight (kDa)

5.81

Isoelectric Point (pI)

53.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015842)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G14590
fragaria_vesca FvH4_4g36010
malus_domestica MD16G1009800.v1.1
prunus_persica Prupe.1G340800_v2.0.a1
pyrus_communis pycom16g00960
rosa_chinensis RchiOBHm_Chr4g0445641
rosa_laevigata RLG00000005722
rosa_multiflora Rmu_sc0003637.1_g000023 Rmu_sc0019383.1_g000003
rosa_roxburghii Rroxscaffold_5G00386120
rosa_rugosa Rorug04G0363600
rosa_samantha Rh4AG425200 Rh4CG451500 Rh4DG433500
rosa_wichuraiana Rw4G036420

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 628
AciI CCGC 9 cut(s) 60, 97, 163, 207, 317, 626, 628, 1055, 1061
AclWI GGATC 1 cut(s) 824
AcsI RAATTY 2 cut(s) 325, 863
AfaI GTAC 2 cut(s) 444, 518
AfiI CCNNNNNNNGG 4 cut(s) 710, 738, 802, 1121
AflIII ACRYGT 1 cut(s) 66
AgeI ACCGGT 1 cut(s) 738
AgsI TTSAA 8 cut(s) 214, 248, 259, 388, 523, 718, 916, 1030
AjnI CCWGG 1 cut(s) 787
AluBI AGCT 3 cut(s) 354, 681, 967
AluI AGCT 3 cut(s) 354, 681, 967
AlwI GGATC 1 cut(s) 824
ApeKI GCWGC 5 cut(s) 39, 266, 678, 967, 1071
ApoI RAATTY 2 cut(s) 325, 863
ArsI GACNNNNNNTTYG 2 cut(s) 274, 306
AsiGI ACCGGT 1 cut(s) 738
AspS9I GGNCC 1 cut(s) 412
AsuHPI GGTGA 3 cut(s) 106, 196, 298
AvaII GGWCC 1 cut(s) 412
BauI CACGAG 1 cut(s) 774
BbsI GAAGAC 2 cut(s) 282, 577
BbvI GCAGC 5 cut(s) 51, 253, 690, 954, 1083
BccI CCATC 1 cut(s) 562
BceAI ACGGC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 789
BciVI GTATCC 1 cut(s) 785
BclI TGATCA 2 cut(s) 799, 819
BfaI CTAG 2 cut(s) 903, 956
BfuI GTATCC 1 cut(s) 785
BisI GCNGC 7 cut(s) 40, 60, 267, 318, 679, 968, 1072
BlsI GCNGC 7 cut(s) 41, 61, 268, 319, 680, 969, 1073
BmcAI AGTACT 1 cut(s) 518
Bme1390I CCNGG 1 cut(s) 789
Bme18I GGWCC 1 cut(s) 412
BmgT120I GGNCC 1 cut(s) 412
BmiI GGNNCC 3 cut(s) 101, 321, 1059
BmrFI CCNGG 1 cut(s) 789
BmrI ACTGGG 1 cut(s) 508
BmsI GCATC 4 cut(s) 253, 583, 631, 921
BmuI ACTGGG 1 cut(s) 508
BpiI GAAGAC 2 cut(s) 282, 577
BplI GAGNNNNNCTC 2 cut(s) 1099, 1131
BpuEI CTTGAG 2 cut(s) 368, 584
BsaBI GATNNNNATC 1 cut(s) 915
BsaJI CCNNGG 4 cut(s) 408, 626, 787, 1049
BsaWI WCCGGW 3 cut(s) 12, 738, 1102
BsaXI ACNNNNNCTCC 4 cut(s) 134, 164, 995, 1025
Bsc4I CCNNNNNNNGG 4 cut(s) 710, 738, 802, 1121
Bse118I RCCGGY 3 cut(s) 25, 223, 738
Bse1I ACTGG 2 cut(s) 514, 1001
Bse3DI GCAATG 1 cut(s) 451
Bse8I GATNNNNATC 1 cut(s) 915
BseBI CCWGG 1 cut(s) 789
BseDI CCNNGG 4 cut(s) 408, 626, 787, 1049
BseGI GGATG 4 cut(s) 268, 598, 646, 811
BseJI GATNNNNATC 1 cut(s) 915
BseLI CCNNNNNNNGG 4 cut(s) 710, 738, 802, 1121
BseMI GCAATG 1 cut(s) 451
BseMII CTCAG 1 cut(s) 462
BseNI ACTGG 2 cut(s) 514, 1001
BseRI GAGGAG 1 cut(s) 128
BseXI GCAGC 5 cut(s) 51, 253, 690, 954, 1083
Bsh1236I CGCG 1 cut(s) 628
BshTI ACCGGT 1 cut(s) 738
BsiSI CCGG 7 cut(s) 13, 26, 74, 94, 224, 739, 1103
BslFI GGGAC 1 cut(s) 295
BslI CCNNNNNNNGG 4 cut(s) 710, 738, 802, 1121
BsmFI GGGAC 1 cut(s) 295
Bsp143I GATC 6 cut(s) 330, 337, 664, 799, 819, 829
Bsp19I CCATGG 1 cut(s) 1049
BspACI CCGC 9 cut(s) 60, 97, 163, 207, 317, 626, 628, 1055, 1061
BspCNI CTCAG 1 cut(s) 463
BspFNI CGCG 1 cut(s) 628
BspHI TCATGA 1 cut(s) 504
BspLI GGNNCC 3 cut(s) 101, 321, 1059
BspPI GGATC 1 cut(s) 824
BspQI GCTCTTC 1 cut(s) 468
BsrDI GCAATG 1 cut(s) 451
BsrFI RCCGGY 3 cut(s) 25, 223, 738
BsrI ACTGG 2 cut(s) 514, 1001
BssAI RCCGGY 3 cut(s) 25, 223, 738
BssECI CCNNGG 4 cut(s) 408, 626, 787, 1049
BssMI GATC 6 cut(s) 330, 337, 664, 799, 819, 829
BssSI CACGAG 1 cut(s) 774
BssT1I CCWWGG 2 cut(s) 408, 1049
Bst2BI CACGAG 1 cut(s) 774
Bst2UI CCWGG 1 cut(s) 789
Bst4CI ACNGT 3 cut(s) 118, 286, 841
Bst6I CTCTTC 7 cut(s) 95, 110, 187, 243, 347, 468, 1025
BstC8I GCNNGC 4 cut(s) 134, 661, 936, 965
BstDEI CTNAG 3 cut(s) 471, 673, 977
BstDSI CCRYGG 2 cut(s) 626, 1049
BstENI CCTNNNNNAGG 1 cut(s) 708
BstF5I GGATG 4 cut(s) 268, 598, 646, 811
BstFNI CGCG 1 cut(s) 628
BstKTI GATC 6 cut(s) 333, 340, 667, 802, 822, 832
BstMBI GATC 6 cut(s) 330, 337, 664, 799, 819, 829
BstMWI GCNNNNNNNGC 1 cut(s) 317
BstNI CCWGG 1 cut(s) 789
BstNSI RCATGY 2 cut(s) 70, 938
BstSCI CCNGG 1 cut(s) 787
BstUI CGCG 1 cut(s) 628
BstV1I GCAGC 5 cut(s) 51, 253, 690, 954, 1083
BstV2I GAAGAC 2 cut(s) 282, 577
BsuI GTATCC 1 cut(s) 785
BtgI CCRYGG 2 cut(s) 626, 1049
BtsCI GGATG 4 cut(s) 268, 598, 646, 811
BtsI GCAGTG 1 cut(s) 873
BtsIMutI CAGTG 3 cut(s) 235, 837, 873
Cac8I GCNNGC 4 cut(s) 134, 661, 936, 965
CciI TCATGA 1 cut(s) 504
Cfr10I RCCGGY 3 cut(s) 25, 223, 738
Cfr13I GGNCC 1 cut(s) 412
Cfr42I CCGCGG 1 cut(s) 629
Csp6I GTAC 2 cut(s) 443, 517
CspAI ACCGGT 1 cut(s) 738
CspCI CAANNNNNGTGG 2 cut(s) 1008, 1043
CviAII CATG 8 cut(s) 67, 312, 505, 797, 935, 971, 1050, 1121
CviJI RGCY 9 cut(s) 42, 59, 320, 354, 382, 573, 681, 967, 1074
CviKI_1 RGCY 9 cut(s) 42, 59, 320, 354, 382, 573, 681, 967, 1074
CviQI GTAC 2 cut(s) 443, 517
DdeI CTNAG 3 cut(s) 471, 673, 977
DpnI GATC 6 cut(s) 332, 339, 666, 801, 821, 831
DpnII GATC 6 cut(s) 330, 337, 664, 799, 819, 829
Eam1104I CTCTTC 7 cut(s) 95, 110, 187, 243, 347, 468, 1025
EarI CTCTTC 7 cut(s) 95, 110, 187, 243, 347, 468, 1025
EciI GGCGGA 1 cut(s) 152
Eco130I CCWWGG 2 cut(s) 408, 1049
Eco47I GGWCC 1 cut(s) 412
EcoNI CCTNNNNNAGG 1 cut(s) 708
EcoRII CCWGG 1 cut(s) 787
EcoT14I CCWWGG 2 cut(s) 408, 1049
EcoT22I ATGCAT 1 cut(s) 936
ErhI CCWWGG 2 cut(s) 408, 1049
FaeI CATG 8 cut(s) 70, 315, 508, 800, 938, 974, 1053, 1124
FaqI GGGAC 1 cut(s) 295
FatI CATG 8 cut(s) 66, 311, 504, 796, 934, 970, 1049, 1120
FauNDI CATATG 1 cut(s) 489
FbaI TGATCA 2 cut(s) 799, 819
Fnu4HI GCNGC 7 cut(s) 40, 60, 267, 318, 679, 968, 1072
FokI GGATG 4 cut(s) 275, 605, 653, 818
Fsp4HI GCNGC 7 cut(s) 40, 60, 267, 318, 679, 968, 1072
FspBI CTAG 2 cut(s) 903, 956
GluI GCNGC 7 cut(s) 40, 60, 267, 318, 679, 968, 1072
HapII CCGG 7 cut(s) 13, 26, 74, 94, 224, 739, 1103
Hin1II CATG 8 cut(s) 70, 315, 508, 800, 938, 974, 1053, 1124
HinfI GANTC 7 cut(s) 47, 77, 388, 616, 714, 916, 1079
HpaII CCGG 7 cut(s) 13, 26, 74, 94, 224, 739, 1103
HphI GGTGA 3 cut(s) 106, 196, 298
Hpy166II GTNNAC 2 cut(s) 445, 899
Hpy188I TCNGA 4 cut(s) 154, 640, 654, 685
Hpy188III TCNNGA 9 cut(s) 385, 505, 563, 613, 776, 803, 869, 956, 992
Hpy8I GTNNAC 2 cut(s) 445, 899
Hpy99I CGWCG 3 cut(s) 86, 301, 1092
HpyAV CCTTC 5 cut(s) 176, 211, 220, 253, 994
HpyCH4III ACNGT 3 cut(s) 118, 286, 841
HpyCH4IV ACGT 1 cut(s) 299
HpyCH4V TGCA 8 cut(s) 644, 694, 927, 934, 938, 970, 1071, 1129
HpyF10VI GCNNNNNNNGC 1 cut(s) 317
HpyF3I CTNAG 3 cut(s) 471, 673, 977
HpySE526I ACGT 1 cut(s) 299
Hsp92II CATG 8 cut(s) 70, 315, 508, 800, 938, 974, 1053, 1124
Ksp22I TGATCA 2 cut(s) 799, 819
KspI CCGCGG 1 cut(s) 629
Kzo9I GATC 6 cut(s) 330, 337, 664, 799, 819, 829
LguI GCTCTTC 1 cut(s) 468
LmnI GCTCC 3 cut(s) 141, 325, 686
Lsp1109I GCAGC 5 cut(s) 51, 253, 690, 954, 1083
LweI GCATC 4 cut(s) 253, 583, 631, 921
MaeI CTAG 2 cut(s) 903, 956
MaeII ACGT 1 cut(s) 299
MaeIII GTNAC 1 cut(s) 1109
MalI GATC 6 cut(s) 332, 339, 666, 801, 821, 831
MboI GATC 6 cut(s) 330, 337, 664, 799, 819, 829
MluCI AATT 8 cut(s) 214, 325, 366, 577, 863, 940, 981, 1066
Mph1103I ATGCAT 1 cut(s) 936
MseI TTAA 2 cut(s) 302, 843
MspA1I CMGCKG 1 cut(s) 628
MspI CCGG 7 cut(s) 13, 26, 74, 94, 224, 739, 1103
MspR9I CCNGG 1 cut(s) 789
MvaI CCWGG 1 cut(s) 789
MvnI CGCG 1 cut(s) 628
MwoI GCNNNNNNNGC 1 cut(s) 317
NcoI CCATGG 1 cut(s) 1049
NdeI CATATG 1 cut(s) 489
NdeII GATC 6 cut(s) 330, 337, 664, 799, 819, 829
NlaIII CATG 8 cut(s) 70, 315, 508, 800, 938, 974, 1053, 1124
NlaIV GGNNCC 3 cut(s) 101, 321, 1059
NmuCI GTSAC 1 cut(s) 1109
NsiI ATGCAT 1 cut(s) 936
NspI RCATGY 2 cut(s) 70, 938
PaeI GCATGC 1 cut(s) 938
PagI TCATGA 1 cut(s) 504
PciI ACATGT 1 cut(s) 66
PciSI GCTCTTC 1 cut(s) 468
PfeI GAWTC 7 cut(s) 47, 77, 388, 616, 714, 916, 1079
PinAI ACCGGT 1 cut(s) 738
PkrI GCNGC 7 cut(s) 41, 61, 268, 319, 680, 969, 1073
PscI ACATGT 1 cut(s) 66
Psp6I CCWGG 1 cut(s) 787
PspGI CCWGG 1 cut(s) 787
PspN4I GGNNCC 3 cut(s) 101, 321, 1059
PspPI GGNCC 1 cut(s) 412
RsaI GTAC 2 cut(s) 444, 518
RsaNI GTAC 2 cut(s) 443, 517
SacII CCGCGG 1 cut(s) 629
SapI GCTCTTC 1 cut(s) 468
SaqAI TTAA 2 cut(s) 302, 843
SatI GCNGC 7 cut(s) 40, 60, 267, 318, 679, 968, 1072
Sau3AI GATC 6 cut(s) 330, 337, 664, 799, 819, 829
Sau96I GGNCC 1 cut(s) 412
ScaI AGTACT 1 cut(s) 518
ScrFI CCNGG 1 cut(s) 789
SfaNI GCATC 4 cut(s) 253, 583, 631, 921
Sfr303I CCGCGG 1 cut(s) 629
SgrBI CCGCGG 1 cut(s) 629
SinI GGWCC 1 cut(s) 412
SmlI CTYRAG 2 cut(s) 347, 563
SmoI CTYRAG 2 cut(s) 347, 563
SphI GCATGC 1 cut(s) 938
Sse9I AATT 8 cut(s) 214, 325, 366, 577, 863, 940, 981, 1066
SsiI CCGC 9 cut(s) 60, 97, 163, 207, 317, 626, 628, 1055, 1061
SspI AATATT 2 cut(s) 761, 847
SspMI CTAG 2 cut(s) 903, 956
StyD4I CCNGG 1 cut(s) 787
StyI CCWWGG 2 cut(s) 408, 1049
TaaI ACNGT 3 cut(s) 118, 286, 841
TaiI ACGT 1 cut(s) 302
TaqI TCGA 1 cut(s) 329
TasI AATT 8 cut(s) 214, 325, 366, 577, 863, 940, 981, 1066
TatI WGTACW 1 cut(s) 516
TauI GCSGC 2 cut(s) 62, 320
TfiI GAWTC 7 cut(s) 47, 77, 388, 616, 714, 916, 1079
Tru1I TTAA 2 cut(s) 302, 843
Tru9I TTAA 2 cut(s) 302, 843
TscAI CASTG 3 cut(s) 235, 844, 880
TseFI GTSAC 1 cut(s) 1109
TseI GCWGC 5 cut(s) 39, 266, 678, 967, 1071
Tsp45I GTSAC 1 cut(s) 1109
TspDTI ATGAA 5 cut(s) 161, 321, 476, 493, 875
TspGWI ACGGA 4 cut(s) 70, 542, 605, 1076
TspRI CASTG 3 cut(s) 235, 844, 880
VpaK11BI GGWCC 1 cut(s) 412
XagI CCTNNNNNAGG 1 cut(s) 708
XapI RAATTY 2 cut(s) 325, 863
XbaI TCTAGA 1 cut(s) 955
XceI RCATGY 2 cut(s) 70, 938
XspI CTAG 2 cut(s) 903, 956
ZrmI AGTACT 1 cut(s) 518
Zsp2I ATGCAT 1 cut(s) 936
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.