Rorug04G0363600

Nucleotide-diphospho-sugar transferase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
53595068 .. 53595391
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0363600.1

Sequence Viewer

Length: 324 bp
ATGAAACTTGTAAGTGGCAACTCCACATACATTGATTTCGATCTTTGCAACTCTAAATCACGGAATGTGAAAGTGTGGTCAGAAGTTCAGGAGGACAAGTTTGCTTTAGACAAAGGTTGGTCAGTTGGTCACTTGACCACTGTGTTGGGAATAGATGGAAGTGGTGGATCATCAGCTCTTGAGGTTAATGGAAACTCAGTGAAAAGTGTTTTGAGACATAAAGTTGAGTGCAACGGAGCATACGTACCTAGAACTCTAGAAGATATCAAAAAAGAAAAGAAGAAGACCAAGAGCGTAATGGTAGAGGTTTGTCACTTCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

11.8

Weight (kDa)

8.79

Isoelectric Point (pI)

24.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015842)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G14590
fragaria_vesca FvH4_4g36010
malus_domestica MD16G1009800.v1.1
prunus_persica Prupe.1G340800_v2.0.a1
pyrus_communis pycom16g00960
rosa_chinensis RchiOBHm_Chr4g0445641
rosa_laevigata RLG00000005722
rosa_multiflora Rmu_sc0003637.1_g000023 Rmu_sc0019383.1_g000003
rosa_roxburghii Rroxscaffold_5G00386120
rosa_rugosa Rorug04G0363600
rosa_samantha Rh4AG425200 Rh4CG451500 Rh4DG433500
rosa_wichuraiana Rw4G036420

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 175
AfaI GTAC 1 cut(s) 246
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
Alw26I GTCTC 1 cut(s) 208
AlwI GGATC 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 290
BccI CCATC 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 208
BfaI CTAG 2 cut(s) 249, 257
BfmI CTRYAG 1 cut(s) 320
BpiI GAAGAC 1 cut(s) 290
BpuEI CTTGAG 1 cut(s) 200
BsaAI YACGTR 1 cut(s) 244
BsaBI GATNNNNATC 1 cut(s) 39
BsaXI ACNNNNNCTCC 4 cut(s) 83, 113, 228, 258
Bse8I GATNNNNATC 1 cut(s) 39
BseJI GATNNNNATC 1 cut(s) 39
BseMII CTCAG 1 cut(s) 210
BsmAI GTCTC 1 cut(s) 208
Bsp143I GATC 2 cut(s) 40, 167
BspCNI CTCAG 1 cut(s) 209
BspPI GGATC 1 cut(s) 175
BssMI GATC 2 cut(s) 40, 167
Bst4CI ACNGT 1 cut(s) 142
BstBAI YACGTR 1 cut(s) 244
BstDEI CTNAG 1 cut(s) 196
BstKTI GATC 2 cut(s) 43, 170
BstMAI GTCTC 1 cut(s) 208
BstMBI GATC 2 cut(s) 40, 167
BstSFI CTRYAG 1 cut(s) 320
BstSNI TACGTA 1 cut(s) 244
BstV2I GAAGAC 1 cut(s) 290
BstXI CCANNNNNNTGG 1 cut(s) 145
BtsIMutI CAGTG 2 cut(s) 138, 204
Csp6I GTAC 1 cut(s) 245
CspCI CAANNNNNGTGG 2 cut(s) 13, 48
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
CviQI GTAC 1 cut(s) 245
DdeI CTNAG 1 cut(s) 196
DpnI GATC 2 cut(s) 42, 169
DpnII GATC 2 cut(s) 40, 167
Eco105I TACGTA 1 cut(s) 244
Eco32I GATATC 1 cut(s) 265
EcoRV GATATC 1 cut(s) 265
FaiI YATR 4 cut(s) 28, 219, 241, 322
FspBI CTAG 2 cut(s) 249, 257
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 3 cut(s) 89, 179, 257
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4IV ACGT 1 cut(s) 243
HpyCH4V TGCA 2 cut(s) 48, 231
HpyF3I CTNAG 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 243
Kzo9I GATC 2 cut(s) 40, 167
LmnI GCTCC 1 cut(s) 236
LpnPI CCDG 1 cut(s) 74
MaeI CTAG 2 cut(s) 249, 257
MaeII ACGT 1 cut(s) 243
MaeIII GTNAC 2 cut(s) 128, 311
MalI GATC 2 cut(s) 42, 169
MboI GATC 2 cut(s) 40, 167
MboII GAAGA 3 cut(s) 272, 292, 295
MnlI CCTC 3 cut(s) 85, 175, 298
MseI TTAA 1 cut(s) 186
NdeII GATC 2 cut(s) 40, 167
NmuCI GTSAC 2 cut(s) 128, 311
PcsI WCGNNNNNNNCGW 1 cut(s) 240
Ppu21I YACGTR 1 cut(s) 244
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 2 cut(s) 40, 167
SetI ASST 6 cut(s) 118, 178, 186, 246, 250, 309
SfcI CTRYAG 1 cut(s) 320
SgeI CNNG 9 cut(s) 20, 72, 101, 109, 145, 191, 261, 269, 301
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
SnaBI TACGTA 1 cut(s) 244
SspMI CTAG 2 cut(s) 249, 257
TaaI ACNGT 1 cut(s) 142
TaiI ACGT 1 cut(s) 246
TaqI TCGA 1 cut(s) 39
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 2 cut(s) 145, 204
TseFI GTSAC 2 cut(s) 128, 311
Tsp45I GTSAC 2 cut(s) 128, 311
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 2 cut(s) 76, 249
TspRI CASTG 2 cut(s) 145, 204
XbaI TCTAGA 1 cut(s) 256
XcmI CCANNNNNNNNNTGG 1 cut(s) 295
XspI CTAG 2 cut(s) 249, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.