Rmu_sc0019430.1_g000001

Vacuolar protein sorting-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019430.1
Physical Location & Seq
Forward (+)
1 .. 482
482 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019430.1_g000001.1.cds

Sequence Viewer

Length: 222 bp
atcatatgtacggtaaagaagcacataatgaatggagggccaaggcgcttaccttttactgttcctcctcttgttttttctgcacttgggttggttaggcgactgcaaggtcaagatggagaggtagttggagaagatatgcctgccacgccgaagacagtttttcagtttctaaatcaggtaatagatcaatacgcctttgttataatatttatgcagtag

Protein Analysis

73

Amino Acids

8.19

Weight (kDa)

9.11

Isoelectric Point (pI)

58.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012830)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 206
AasI GACNNNNNNGTC 1 cut(s) 108
AfaI GTAC 1 cut(s) 10
AoxI GGCC 1 cut(s) 38
AspLEI GCGC 1 cut(s) 48
AspS9I GGNCC 1 cut(s) 38
BbsI GAAGAC 1 cut(s) 161
BccI CCATC 1 cut(s) 110
BfoI RGCGCY 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 41
BsaXI ACNNNNNCTCC 4 cut(s) 49, 79, 111, 141
BseDI CCNNGG 1 cut(s) 41
BseRI GAGGAG 1 cut(s) 57
BsgI GTGCAG 1 cut(s) 66
BshFI GGCC 1 cut(s) 40
BsnI GGCC 1 cut(s) 40
Bsp143I GATC 1 cut(s) 187
BspANI GGCC 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 41
BssMI GATC 1 cut(s) 187
BssT1I CCWWGG 1 cut(s) 41
Bst4CI ACNGT 3 cut(s) 13, 61, 160
BstC8I GCNNGC 1 cut(s) 144
BstH2I RGCGCY 1 cut(s) 49
BstHHI GCGC 1 cut(s) 48
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstV2I GAAGAC 1 cut(s) 161
BsuRI GGCC 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 144
CfoI GCGC 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 38
Csp6I GTAC 1 cut(s) 9
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
CviQI GTAC 1 cut(s) 9
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
DrdI GACNNNNNNGTC 1 cut(s) 108
DseDI GACNNNNNNGTC 1 cut(s) 108
Eco130I CCWWGG 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 41
ErhI CCWWGG 1 cut(s) 41
FaiI YATR 6 cut(s) 5, 7, 26, 140, 206, 215
FauNDI CATATG 1 cut(s) 5
GlaI GCGC 1 cut(s) 47
HaeII RGCGCY 1 cut(s) 49
HaeIII GGCC 1 cut(s) 40
HhaI GCGC 1 cut(s) 48
Hin6I GCGC 1 cut(s) 46
HinP1I GCGC 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 113
HpyCH4III ACNGT 3 cut(s) 13, 61, 160
HpyCH4V TGCA 3 cut(s) 83, 106, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HspAI GCGC 1 cut(s) 46
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 2 cut(s) 156, 164
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 2 cut(s) 146, 166
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 4 cut(s) 29, 75, 78, 115
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeI CATATG 1 cut(s) 5
NdeII GATC 1 cut(s) 187
PsiI TTATAA 1 cut(s) 206
PspPI GGNCC 1 cut(s) 38
RsaI GTAC 1 cut(s) 10
RsaNI GTAC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 187
Sau96I GGNCC 1 cut(s) 38
SetI ASST 4 cut(s) 55, 112, 126, 183
SgeI CNNG 8 cut(s) 54, 83, 98, 119, 125, 155, 160, 191
SspI AATATT 1 cut(s) 210
StyI CCWWGG 1 cut(s) 41
TaaI ACNGT 3 cut(s) 13, 61, 160
TspDTI ATGAA 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.