Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0025302.1

Orthogroup ID

OG0005256

Physical Location & Seq

Genomic Coordinates Reverse (-)

99 .. 1250

Gene Structure 1152 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0025302.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1056 bp

atgcttttcagtattcctgatttctttgtagggtttggtaacaaaggttcttcagattctgactcagttaggagccctacatctcctctggacctcaggcctttttcaaatcttagcaacccatttagacttaggtccgctcgatcatcatcccacaatggaaatcacaagaaatgggattgtaggaaagcaggccttggcattgtcaatttccttgttgatgaaaccaaagctactagtgaagttcttggttcatcgaagaggaaaaccataatttttcgaccacaggtggggaaaaacaactctcactcctcaaagctctgttctggttcagatgattattccatgaagtcccaatctttacccagaaactacataattaggccactttctgaaaccatatctctcaatccccaactcaaaccagataaagtgaatgtttcatctgggtttgtgggacttcctttggaatctgaaccatctgaaaacattgaaccatttttgttggactccagcagggattcctcactgattgtctctatgcaaggagaaagttcgttgggttttaaacctagttcacttccagtacccgttgtctctaaccctcaatatgcatcctctatccctgctagagagatggaactttctgaggactatacctgtataatttctcatggtccaaacccgaagactactcatattttttgtgactgtatattggaatgtcacacaaaagatttaaacaatgttgacaaagaaatagtcgagatagaatcacctcgagtgggtcagcaccaggagggattggcacatgacccttcagatgaaattttgagattctgttacacctgcaagaagaacttggtaggagaggaaatttacatgtgcagaagtgagaaagcattttgtagttttgattgtcattcagagaagatttttactgaagaggaagcagaagagacttgggataaatctgcaggaacctctcctgaaagctaccaggaagatctcttcttattgggtatgcatagtcaggagactcgggacatagagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-FLZ

Protein Analysis

351

Amino Acids

39.12

Weight (kDa)

5.25

Isoelectric Point (pI)

66.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005256)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G79970 AT1G79970 AT1G79970
fragaria_vesca	FvH4_6g31090 FvH4_6g31090 FvH4_6g31090 FvH4_6g31090 FvH4_6g31090 FvH4_6g31090 FvH4_6g31090 FvH4_6g31090 FvH4_6g31090
prunus_persica	Prupe.3G071600_v2.0.a1 Prupe.3G071600_v2.0.a1 Prupe.3G071600_v2.0.a1 Prupe.3G071600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0137791
rosa_laevigata	RLG00000019676
rosa_multiflora	Rmu_sc0025302.1_g000001 Rmu_sc0041296.1_g000001
rosa_roxburghii	Rroxscaffold_2G00106840
rosa_rugosa	Rorug02G0345800 Rorug02G0345900 Rorug02G0346000
rosa_samantha	Rh2AG392800 Rh2BG400500 Rh2CG379500 Rh2DG415400
rosa_wichuraiana	Rw2G032180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	857
Acc36I	ACCTGC	1 cut(s)	857
AccBSI	CCGCTC	1 cut(s)	140
AciI	CCGC	1 cut(s)	138
AcsI	RAATTY	2 cut(s)	828, 876
AcuI	CTGAAG	3 cut(s)	36, 804, 963
AfaI	GTAC	1 cut(s)	588
AfiI	CCNNNNNNNGG	2 cut(s)	290, 785
AflIII	ACRYGT	1 cut(s)	882
AgsI	TTSAA	2 cut(s)	108, 494
AhlI	ACTAGT	1 cut(s)	236
AjnI	CCWGG	2 cut(s)	795, 999
AluBI	AGCT	3 cut(s)	233, 319, 996
AluI	AGCT	3 cut(s)	233, 319, 996
Alw26I	GTCTC	4 cut(s)	541, 601, 953, 1031
AlwNI	CAGNNNCTG	1 cut(s)	59
Ama87I	CYCGRG	2 cut(s)	780, 1041
AoxI	GGCC	3 cut(s)	98, 193, 383
ApoI	RAATTY	2 cut(s)	828, 876
ArsI	GACNNNNNNTTYG	2 cut(s)	747, 779
AspS9I	GGNCC	3 cut(s)	91, 135, 677
AsuHPI	GGTGA	1 cut(s)	768
AvaI	CYCGRG	2 cut(s)	780, 1041
AvaII	GGWCC	3 cut(s)	91, 135, 677
AxyI	CCTNAGG	1 cut(s)	95
BanII	GRGCYC	1 cut(s)	77
BbsI	GAAGAC	1 cut(s)	695
BccI	CCATC	2 cut(s)	487, 631
BciT130I	CCWGG	2 cut(s)	797, 1001
BcoDI	GTCTC	4 cut(s)	541, 601, 953, 1031
BcuI	ACTAGT	1 cut(s)	236
BfaI	CTAG	3 cut(s)	237, 573, 630
BfmI	CTRYAG	1 cut(s)	975
BfuAI	ACCTGC	1 cut(s)	857
BglII	AGATCT	1 cut(s)	1006
Bme1390I	CCNGG	2 cut(s)	797, 1001
Bme18I	GGWCC	3 cut(s)	91, 135, 677
BmeT110I	CYCGRG	2 cut(s)	780, 1041
BmgT120I	GGNCC	3 cut(s)	91, 135, 677
BmiI	GGNNCC	2 cut(s)	74, 982
BmrFI	CCNGG	2 cut(s)	797, 1001
BmsI	GCATC	1 cut(s)	623
BoxI	GACNNNNGTC	1 cut(s)	133
BpiI	GAAGAC	1 cut(s)	695
BpmI	CTGGAG	1 cut(s)	496
BsaBI	GATNNNNATC	1 cut(s)	148
BsaJI	CCNNGG	1 cut(s)	196
BsaXI	ACNNNNNCTCC	2 cut(s)	293, 323
Bsc4I	CCNNNNNNNGG	2 cut(s)	290, 785
Bse1I	ACTGG	1 cut(s)	584
Bse21I	CCTNAGG	1 cut(s)	95
Bse8I	GATNNNNATC	1 cut(s)	148
BseBI	CCWGG	2 cut(s)	797, 1001
BseDI	CCNNGG	1 cut(s)	196
BseGI	GGATG	2 cut(s)	149, 614
BseJI	GATNNNNATC	1 cut(s)	148
BseLI	CCNNNNNNNGG	2 cut(s)	290, 785
BseMII	CTCAG	3 cut(s)	78, 109, 639
BseNI	ACTGG	1 cut(s)	584
BseRI	GAGGAG	2 cut(s)	75, 301
BsgI	GTGCAG	1 cut(s)	907
BshFI	GGCC	3 cut(s)	100, 195, 385
BsiHKCI	CYCGRG	2 cut(s)	780, 1041
BslFI	GGGAC	2 cut(s)	337, 471
BslI	CCNNNNNNNGG	2 cut(s)	290, 785
BsmAI	GTCTC	4 cut(s)	541, 601, 953, 1031
BsmFI	GGGAC	2 cut(s)	337, 471
BsnI	GGCC	3 cut(s)	100, 195, 385
BsoBI	CYCGRG	2 cut(s)	780, 1041
Bsp1286I	GDGCHC	1 cut(s)	77
Bsp143I	GATC	2 cut(s)	143, 1006
BspACI	CCGC	1 cut(s)	138
BspANI	GGCC	3 cut(s)	100, 195, 385
BspCNI	CTCAG	3 cut(s)	77, 108, 640
BspLI	GGNNCC	2 cut(s)	74, 982
BspMAI	CTGCAG	1 cut(s)	979
BspMI	ACCTGC	1 cut(s)	857
BsrBI	CCGCTC	1 cut(s)	140
BsrI	ACTGG	1 cut(s)	584
BssECI	CCNNGG	1 cut(s)	196
BssMI	GATC	2 cut(s)	143, 1006
BssT1I	CCWWGG	1 cut(s)	196
Bst2UI	CCWGG	2 cut(s)	797, 1001
Bst4CI	ACNGT	1 cut(s)	713
Bst6I	CTCTTC	4 cut(s)	254, 939, 951, 1016
BstC8I	GCNNGC	1 cut(s)	193
BstDEI	CTNAG	5 cut(s)	64, 95, 113, 131, 648
BstF5I	GGATG	2 cut(s)	149, 614
BstKTI	GATC	2 cut(s)	146, 1009
BstMAI	GTCTC	4 cut(s)	541, 601, 953, 1031
BstMBI	GATC	2 cut(s)	143, 1006
BstNI	CCWGG	2 cut(s)	797, 1001
BstNSI	RCATGY	1 cut(s)	886
BstPAI	GACNNNNGTC	1 cut(s)	133
BstSCI	CCNGG	2 cut(s)	795, 999
BstSFI	CTRYAG	1 cut(s)	975
BstV2I	GAAGAC	1 cut(s)	695
BstX2I	RGATCY	1 cut(s)	1006
BstYI	RGATCY	1 cut(s)	1006
Bsu36I	CCTNAGG	1 cut(s)	95
BsuRI	GGCC	3 cut(s)	100, 195, 385
BtsCI	GGATG	2 cut(s)	149, 614
BtsIMutI	CAGTG	1 cut(s)	527
BveI	ACCTGC	1 cut(s)	857
Cac8I	GCNNGC	1 cut(s)	193
CaiI	CAGNNNCTG	1 cut(s)	59
Cfr13I	GGNCC	3 cut(s)	91, 135, 677
Csp6I	GTAC	1 cut(s)	587
CviAII	CATG	4 cut(s)	346, 674, 812, 883
CviJI	RGCY	7 cut(s)	75, 100, 195, 233, 319, 385, 996
CviKI_1	RGCY	7 cut(s)	75, 100, 195, 233, 319, 385, 996
CviQI	GTAC	1 cut(s)	587
DdeI	CTNAG	5 cut(s)	64, 95, 113, 131, 648
DpnI	GATC	2 cut(s)	145, 1008
DpnII	GATC	2 cut(s)	143, 1006
DraI	TTTAAA	2 cut(s)	568, 741
Eam1104I	CTCTTC	4 cut(s)	254, 939, 951, 1016
EarI	CTCTTC	4 cut(s)	254, 939, 951, 1016
Eco130I	CCWWGG	1 cut(s)	196
Eco147I	AGGCCT	2 cut(s)	100, 195
Eco24I	GRGCYC	1 cut(s)	77
Eco47I	GGWCC	3 cut(s)	91, 135, 677
Eco57I	CTGAAG	3 cut(s)	36, 804, 963
Eco81I	CCTNAGG	1 cut(s)	95
Eco88I	CYCGRG	2 cut(s)	780, 1041
EcoRII	CCWGG	2 cut(s)	795, 999
EcoT14I	CCWWGG	1 cut(s)	196
EcoT22I	ATGCAT	2 cut(s)	616, 1029
EcoT38I	GRGCYC	1 cut(s)	77
ErhI	CCWWGG	1 cut(s)	196
FaeI	CATG	4 cut(s)	349, 677, 815, 886
FalI	AAGNNNNNCTT	4 cut(s)	180, 212, 845, 877
FaqI	GGGAC	2 cut(s)	337, 471
FatI	CATG	4 cut(s)	345, 673, 811, 882
FokI	GGATG	2 cut(s)	136, 601
FriOI	GRGCYC	1 cut(s)	77
FspBI	CTAG	3 cut(s)	237, 573, 630
GsuI	CTGGAG	1 cut(s)	496
HaeIII	GGCC	3 cut(s)	100, 195, 385
Hin1II	CATG	4 cut(s)	349, 677, 815, 886
HincII	GTYRAC	1 cut(s)	751
HindII	GTYRAC	1 cut(s)	751
HinfI	GANTC	8 cut(s)	56, 62, 470, 509, 521, 773, 837, 1039
HphI	GGTGA	1 cut(s)	768
Hpy166II	GTNNAC	2 cut(s)	578, 751
Hpy188I	TCNGA	9 cut(s)	55, 61, 334, 394, 475, 484, 649, 823, 928
Hpy188III	TCNNGA	6 cut(s)	17, 89, 766, 989, 1034, 1043
Hpy8I	GTNNAC	2 cut(s)	578, 751
HpyAV	CCTTC	1 cut(s)	828
HpyCH4III	ACNGT	1 cut(s)	713
HpyCH4V	TGCA	6 cut(s)	544, 614, 852, 888, 977, 1027
HpyF3I	CTNAG	5 cut(s)	64, 95, 113, 131, 648
Hsp92II	CATG	4 cut(s)	349, 677, 815, 886
Kzo9I	GATC	2 cut(s)	143, 1006
LmnI	GCTCC	1 cut(s)	72
LweI	GCATC	1 cut(s)	623
MaeI	CTAG	3 cut(s)	237, 573, 630
MaeIII	GTNAC	4 cut(s)	38, 707, 725, 842
MalI	GATC	2 cut(s)	145, 1008
MbiI	CCGCTC	1 cut(s)	140
MboI	GATC	2 cut(s)	143, 1006
MboII	GAAGA	9 cut(s)	42, 271, 700, 868, 943, 956, 968, 1003, 1016
MflI	RGATCY	1 cut(s)	1006
MhlI	GDGCHC	1 cut(s)	77
MluCI	AATT	6 cut(s)	208, 273, 378, 666, 828, 876
MlyI	GAGTC	3 cut(s)	56, 503, 1033
MmeI	TCCRAC	1 cut(s)	486
Mph1103I	ATGCAT	2 cut(s)	616, 1029
MseI	TTAA	2 cut(s)	567, 740
MspR9I	CCNGG	2 cut(s)	797, 1001
MvaI	CCWGG	2 cut(s)	797, 1001
NdeII	GATC	2 cut(s)	143, 1006
NlaIII	CATG	4 cut(s)	349, 677, 815, 886
NlaIV	GGNNCC	2 cut(s)	74, 982
NmuCI	GTSAC	2 cut(s)	707, 725
NsiI	ATGCAT	2 cut(s)	616, 1029
NspI	RCATGY	1 cut(s)	886
PaeR7I	CTCGAG	1 cut(s)	780
PaqCI	CACCTGC	1 cut(s)	857
PceI	AGGCCT	2 cut(s)	100, 195
PciI	ACATGT	1 cut(s)	882
PfeI	GAWTC	5 cut(s)	56, 470, 521, 773, 837
PleI	GAGTC	3 cut(s)	56, 503, 1033
PpsI	GAGTC	3 cut(s)	56, 503, 1033
PscI	ACATGT	1 cut(s)	882
PshAI	GACNNNNGTC	1 cut(s)	133
Psp6I	CCWGG	2 cut(s)	795, 999
PspGI	CCWGG	2 cut(s)	795, 999
PspN4I	GGNNCC	2 cut(s)	74, 982
PspPI	GGNCC	3 cut(s)	91, 135, 677
PspXI	VCTCGAGB	1 cut(s)	780
PsrI	GAACNNNNNNTAC	2 cut(s)	31, 63
PstI	CTGCAG	1 cut(s)	979
PstNI	CAGNNNCTG	1 cut(s)	59
PsuI	RGATCY	1 cut(s)	1006
RsaI	GTAC	1 cut(s)	588
RsaNI	GTAC	1 cut(s)	587
SaqAI	TTAA	2 cut(s)	567, 740
Sau3AI	GATC	2 cut(s)	143, 1006
Sau96I	GGNCC	3 cut(s)	91, 135, 677
SchI	GAGTC	3 cut(s)	56, 503, 1033
ScrFI	CCNGG	2 cut(s)	797, 1001
SduI	GDGCHC	1 cut(s)	77
SfaNI	GCATC	1 cut(s)	623
SfcI	CTRYAG	1 cut(s)	975
Sfr274I	CTCGAG	1 cut(s)	780
SinI	GGWCC	3 cut(s)	91, 135, 677
SlaI	CTCGAG	1 cut(s)	780
SmlI	CTYRAG	1 cut(s)	780
SmoI	CTYRAG	1 cut(s)	780
SpeI	ACTAGT	1 cut(s)	236
Sse9I	AATT	6 cut(s)	208, 273, 378, 666, 828, 876
SseBI	AGGCCT	2 cut(s)	100, 195
SsiI	CCGC	1 cut(s)	138
SspMI	CTAG	3 cut(s)	237, 573, 630
StuI	AGGCCT	2 cut(s)	100, 195
StyD4I	CCNGG	2 cut(s)	795, 999
StyI	CCWWGG	1 cut(s)	196
TaaI	ACNGT	1 cut(s)	713
TaqI	TCGA	5 cut(s)	142, 257, 280, 765, 781
TasI	AATT	6 cut(s)	208, 273, 378, 666, 828, 876
TfiI	GAWTC	5 cut(s)	56, 470, 521, 773, 837
Tru1I	TTAA	2 cut(s)	567, 740
Tru9I	TTAA	2 cut(s)	567, 740
TscAI	CASTG	1 cut(s)	534
TseFI	GTSAC	2 cut(s)	707, 725
Tsp45I	GTSAC	2 cut(s)	707, 725
TspDTI	ATGAA	5 cut(s)	237, 243, 362, 432, 840
TspRI	CASTG	1 cut(s)	534
VpaK11BI	GGWCC	3 cut(s)	91, 135, 677
XapI	RAATTY	2 cut(s)	828, 876
XceI	RCATGY	1 cut(s)	886
XhoI	CTCGAG	1 cut(s)	780
XspI	CTAG	3 cut(s)	237, 573, 630
Zsp2I	ATGCAT	2 cut(s)	616, 1029

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.