Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026312.1

Orthogroup ID

OG0019019

Physical Location & Seq

Genomic Coordinates Reverse (-)

6355 .. 8309

Gene Structure 1955 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026312.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 621 bp

atgttccacagtttgctgtctcctccagctcatcctgtttggaagtgcaatggaaggattgcaacaacaatgacaaataaacgcaaagcaagcaacgacaacttgatgctgcaaccaccactcaaaaaattagctcatgatgaaattccaaaagagattggcactctgaatcagttggagaagttgagtgtgctatttaatgcccttgaagggcatgttcccctggctgtgttcaacacgtcttctctgaatcttctggctctatctacaaacaatttgaatggtagtgttccagacaatatgtgccaacatcttctgaaccttcaaggtttgtatttgtctaaaaacaattttgacggccaacttccatccaaatggtcgcggtgcaaacatcttcttgtattatcgatggggtataacaatttcagcgggagcacacccaaagatatttggaacttaactcagataaagacgatttaccttggctccaactatttgacaggtaccataccaaatgagattggtcatcttccatgtttagaggaatttgtcctgggtggtaataatctcagtggcctcatcaatcttcaatatgtccacaatatcaataatatcacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04016 ko04626 map04016 map04626

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

206

Amino Acids

22.86

Weight (kDa)

8.67

Isoelectric Point (pI)

31.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019019)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0042091 RchiOBHm_Chr5g0042131 RchiOBHm_Chr5g0042141
rosa_multiflora	Rmu_co8371599.1_g000001 Rmu_sc0005255.1_g000022 Rmu_sc0026312.1_g000001
rosa_roxburghii	Rroxscaffold_1G00065110
rosa_rugosa	Rorug05G0198100
rosa_samantha	Rh5BG265700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	503
AccB1I	GGYRCC	1 cut(s)	503
AccII	CGCG	1 cut(s)	382
AciI	CCGC	2 cut(s)	382, 429
AcoI	YGGCCR	1 cut(s)	358
AcsI	RAATTY	2 cut(s)	144, 545
AfaI	GTAC	1 cut(s)	505
AfiI	CCNNNNNNNGG	1 cut(s)	210
AflIII	ACRYGT	1 cut(s)	237
AgsI	TTSAA	5 cut(s)	209, 235, 280, 326, 590
AjiI	CACGTC	1 cut(s)	240
AjnI	CCWGG	2 cut(s)	222, 552
AluBI	AGCT	2 cut(s)	29, 134
AluI	AGCT	2 cut(s)	29, 134
Alw21I	GWGCWC	1 cut(s)	437
Alw26I	GTCTC	1 cut(s)	24
AoxI	GGCC	2 cut(s)	358, 574
ApeKI	GCWGC	1 cut(s)	109
ApoI	RAATTY	2 cut(s)	144, 545
Asp718I	GGTACC	1 cut(s)	503
BanI	GGYRCC	1 cut(s)	503
BbsI	GAAGAC	1 cut(s)	234
Bbv12I	GWGCWC	1 cut(s)	437
BbvI	GCAGC	1 cut(s)	96
BccI	CCATC	2 cut(s)	376, 403
BceAI	ACGGC	1 cut(s)	373
BciT130I	CCWGG	2 cut(s)	224, 554
BcoDI	GTCTC	1 cut(s)	24
BisI	GCNGC	1 cut(s)	110
BlsI	GCNGC	1 cut(s)	111
Bme1390I	CCNGG	2 cut(s)	224, 554
BmgBI	CACGTC	1 cut(s)	240
BmiI	GGNNCC	2 cut(s)	487, 505
BmrFI	CCNGG	2 cut(s)	224, 554
BmsI	GCATC	1 cut(s)	96
BpiI	GAAGAC	1 cut(s)	234
BpmI	CTGGAG	1 cut(s)	9
Bsa29I	ATCGAT	1 cut(s)	407
BsaJI	CCNNGG	3 cut(s)	222, 481, 553
BsaXI	ACNNNNNCTCC	2 cut(s)	470, 500
Bsc4I	CCNNNNNNNGG	1 cut(s)	210
Bse3DI	GCAATG	1 cut(s)	55
BseBI	CCWGG	2 cut(s)	224, 554
BseCI	ATCGAT	1 cut(s)	407
BseDI	CCNNGG	3 cut(s)	222, 481, 553
BseGI	GGATG	2 cut(s)	31, 368
BseLI	CCNNNNNNNGG	1 cut(s)	210
BseMI	GCAATG	1 cut(s)	55
BseMII	CTCAG	2 cut(s)	476, 583
BseRI	GAGGAG	1 cut(s)	12
BseXI	GCAGC	1 cut(s)	96
Bsh1236I	CGCG	1 cut(s)	382
BshFI	GGCC	2 cut(s)	360, 576
BshNI	GGYRCC	1 cut(s)	503
BshVI	ATCGAT	1 cut(s)	407
BsiHKAI	GWGCWC	1 cut(s)	437
BslI	CCNNNNNNNGG	1 cut(s)	210
BsmAI	GTCTC	1 cut(s)	24
BsnI	GGCC	2 cut(s)	360, 576
Bsp1286I	GDGCHC	1 cut(s)	437
BspACI	CCGC	2 cut(s)	382, 429
BspANI	GGCC	2 cut(s)	360, 576
BspCNI	CTCAG	2 cut(s)	475, 582
BspDI	ATCGAT	1 cut(s)	407
BspFNI	CGCG	1 cut(s)	382
BspHI	TCATGA	1 cut(s)	136
BspLI	GGNNCC	2 cut(s)	487, 505
BspT107I	GGYRCC	1 cut(s)	503
BsrDI	GCAATG	1 cut(s)	55
BssECI	CCNNGG	3 cut(s)	222, 481, 553
BssT1I	CCWWGG	1 cut(s)	481
Bst2UI	CCWGG	2 cut(s)	224, 554
Bst4CI	ACNGT	1 cut(s)	11
BstC8I	GCNNGC	1 cut(s)	91
BstDEI	CTNAG	2 cut(s)	462, 569
BstF5I	GGATG	2 cut(s)	31, 368
BstFNI	CGCG	1 cut(s)	382
BstMAI	GTCTC	1 cut(s)	24
BstMWI	GCNNNNNNNGC	1 cut(s)	90
BstNI	CCWGG	2 cut(s)	224, 554
BstNSI	RCATGY	1 cut(s)	218
BstSCI	CCNGG	2 cut(s)	222, 552
BstUI	CGCG	1 cut(s)	382
BstV1I	GCAGC	1 cut(s)	96
BstV2I	GAAGAC	1 cut(s)	234
BstXI	CCANNNNNNTGG	1 cut(s)	375
Bsu15I	ATCGAT	1 cut(s)	407
BsuRI	GGCC	2 cut(s)	360, 576
BsuTUI	ATCGAT	1 cut(s)	407
BtrI	CACGTC	1 cut(s)	240
BtsCI	GGATG	2 cut(s)	31, 368
BtsIMutI	CAGTG	1 cut(s)	577
Cac8I	GCNNGC	1 cut(s)	91
CciI	TCATGA	1 cut(s)	136
ClaI	ATCGAT	1 cut(s)	407
Csp6I	GTAC	1 cut(s)	504
CviAII	CATG	3 cut(s)	137, 215, 534
CviJI	RGCY	7 cut(s)	29, 134, 227, 260, 360, 486, 576
CviKI_1	RGCY	7 cut(s)	29, 134, 227, 260, 360, 486, 576
CviQI	GTAC	1 cut(s)	504
DdeI	CTNAG	2 cut(s)	462, 569
EaeI	YGGCCR	1 cut(s)	358
Eco130I	CCWWGG	1 cut(s)	481
EcoRII	CCWGG	2 cut(s)	222, 552
EcoT14I	CCWWGG	1 cut(s)	481
ErhI	CCWWGG	1 cut(s)	481
FaeI	CATG	3 cut(s)	140, 218, 537
FaiI	YATR	7 cut(s)	138, 216, 302, 417, 509, 535, 594
FatI	CATG	3 cut(s)	136, 214, 533
FauI	CCCGC	1 cut(s)	422
Fnu4HI	GCNGC	1 cut(s)	110
FokI	GGATG	2 cut(s)	18, 355
Fsp4HI	GCNGC	1 cut(s)	110
GluI	GCNGC	1 cut(s)	110
GsuI	CTGGAG	1 cut(s)	9
HaeIII	GGCC	2 cut(s)	360, 576
Hin1II	CATG	3 cut(s)	140, 218, 537
HinfI	GANTC	2 cut(s)	169, 250
Hpy166II	GTNNAC	1 cut(s)	598
Hpy188I	TCNGA	4 cut(s)	168, 249, 318, 465
Hpy188III	TCNNGA	2 cut(s)	137, 293
Hpy8I	GTNNAC	1 cut(s)	598
HpyAV	CCTTC	3 cut(s)	48, 203, 332
HpyCH4III	ACNGT	1 cut(s)	11
HpyCH4IV	ACGT	1 cut(s)	239
HpyCH4V	TGCA	4 cut(s)	48, 62, 112, 387
HpyF10VI	GCNNNNNNNGC	1 cut(s)	90
HpyF3I	CTNAG	2 cut(s)	462, 569
HpySE526I	ACGT	1 cut(s)	239
Hsp92II	CATG	3 cut(s)	140, 218, 537
KpnI	GGTACC	1 cut(s)	507
LmnI	GCTCC	2 cut(s)	432, 491
LpnPI	CCDG	9 cut(s)	39, 48, 209, 236, 242, 306, 486, 539, 566
Lsp1109I	GCAGC	1 cut(s)	96
LweI	GCATC	1 cut(s)	96
MaeII	ACGT	1 cut(s)	239
MboII	GAAGA	6 cut(s)	234, 245, 305, 386, 521, 578
MhlI	GDGCHC	1 cut(s)	437
MluCI	AATT	6 cut(s)	128, 144, 274, 349, 421, 545
MmeI	TCCRAC	2 cut(s)	156, 513
MnlI	CCTC	3 cut(s)	33, 535, 587
MseI	TTAA	2 cut(s)	198, 458
MslI	CAYNNNNRTG	1 cut(s)	373
MspA1I	CMGCKG	1 cut(s)	429
MspR9I	CCNGG	2 cut(s)	224, 554
MvaI	CCWGG	2 cut(s)	224, 554
MvnI	CGCG	1 cut(s)	382
MwoI	GCNNNNNNNGC	1 cut(s)	90
NlaIII	CATG	3 cut(s)	140, 218, 537
NlaIV	GGNNCC	2 cut(s)	487, 505
NspI	RCATGY	1 cut(s)	218
PagI	TCATGA	1 cut(s)	136
PfeI	GAWTC	2 cut(s)	169, 250
PkrI	GCNGC	1 cut(s)	111
Psp6I	CCWGG	2 cut(s)	222, 552
PspGI	CCWGG	2 cut(s)	222, 552
PspN4I	GGNNCC	2 cut(s)	487, 505
RsaI	GTAC	1 cut(s)	505
RsaNI	GTAC	1 cut(s)	504
RseI	CAYNNNNRTG	1 cut(s)	373
SaqAI	TTAA	2 cut(s)	198, 458
SatI	GCNGC	1 cut(s)	110
ScrFI	CCNGG	2 cut(s)	224, 554
SduI	GDGCHC	1 cut(s)	437
SetI	ASST	7 cut(s)	31, 136, 242, 324, 331, 483, 505
SfaNI	GCATC	1 cut(s)	96
SmiMI	CAYNNNNRTG	1 cut(s)	373
Sse9I	AATT	6 cut(s)	128, 144, 274, 349, 421, 545
SsiI	CCGC	2 cut(s)	382, 429
StyD4I	CCNGG	2 cut(s)	222, 552
StyI	CCWWGG	1 cut(s)	481
TaaI	ACNGT	1 cut(s)	11
TaiI	ACGT	1 cut(s)	242
TaqI	TCGA	1 cut(s)	407
TasI	AATT	6 cut(s)	128, 144, 274, 349, 421, 545
TfiI	GAWTC	2 cut(s)	169, 250
Tru1I	TTAA	2 cut(s)	198, 458
Tru9I	TTAA	2 cut(s)	198, 458
TscAI	CASTG	1 cut(s)	577
TseI	GCWGC	1 cut(s)	109
TspDTI	ATGAA	1 cut(s)	156
TspRI	CASTG	1 cut(s)	577
XapI	RAATTY	2 cut(s)	144, 545
XceI	RCATGY	1 cut(s)	218

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.