Rh5BG265700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
33216165 .. 33217153
989 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG265700.1

Sequence Viewer

Length: 321 bp
ATGGCATATAATCATTTACAAGGCCCTCTTCCTAGTTCACTTGGCAACTCGCCAGGCTTGGTAGGCTTGGATTTACCCCAAAATAATTTGTCAGGAGCTATCCCAAAGCTTCTTGAAGGCTCTGTTATATCTGAATGTCTTTCAACCAACTCCAAGGAGAAGTTTCAACAGGCGGACCTTTCAAAAATTTGTTTGCTCAATCATTTATTTCAAAAACTGGACTCTCTGGTGCATTCCAATTGCATGTTCCACCATGAAAAAAGATGGCATAGATGTGACATACATTTCTCATTTCGGGGATTTTATCAGCAACTCTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.02

Weight (kDa)

7.76

Isoelectric Point (pI)

52.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 173
AcsI RAATTY 1 cut(s) 186
AgsI TTSAA 5 cut(s) 116, 144, 167, 183, 212
AjnI CCWGG 1 cut(s) 52
AjuI GAANNNNNNNTTGG 2 cut(s) 230, 262
AluBI AGCT 2 cut(s) 98, 109
AluI AGCT 2 cut(s) 98, 109
AoxI GGCC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 23, 175
AvaII GGWCC 1 cut(s) 175
BccI CCATC 1 cut(s) 258
BciT130I CCWGG 1 cut(s) 54
BfaI CTAG 2 cut(s) 33, 319
Bme1390I CCNGG 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 175
BmgT120I GGNCC 2 cut(s) 23, 175
BmrFI CCNGG 1 cut(s) 54
BsaJI CCNNGG 1 cut(s) 153
Bse1I ACTGG 1 cut(s) 222
BseBI CCWGG 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 153
BseNI ACTGG 1 cut(s) 222
BshFI GGCC 1 cut(s) 24
BsmI GAATGC 1 cut(s) 232
BsnI GGCC 1 cut(s) 24
BspACI CCGC 1 cut(s) 173
BspANI GGCC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 222
BssECI CCNNGG 1 cut(s) 153
BssT1I CCWWGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 54
Bst6I CTCTTC 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 63
BstNI CCWGG 1 cut(s) 54
BstNSI RCATGY 1 cut(s) 247
BstSCI CCNGG 1 cut(s) 52
BsuRI GGCC 1 cut(s) 24
Cfr13I GGNCC 2 cut(s) 23, 175
CviAII CATG 2 cut(s) 244, 254
CviJI RGCY 6 cut(s) 24, 57, 66, 98, 109, 120
CviKI_1 RGCY 6 cut(s) 24, 57, 66, 98, 109, 120
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
EciI GGCGGA 1 cut(s) 188
Eco130I CCWWGG 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 52
EcoT14I CCWWGG 1 cut(s) 153
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 2 cut(s) 247, 257
FaiI YATR 7 cut(s) 7, 9, 128, 245, 255, 270, 281
FalI AAGNNNNNCTT 2 cut(s) 12, 44
FatI CATG 2 cut(s) 243, 253
FspBI CTAG 2 cut(s) 33, 319
HaeIII GGCC 1 cut(s) 24
Hin1II CATG 2 cut(s) 247, 257
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 1 cut(s) 221
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 93, 113
Hpy8I GTNNAC 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 110
HpyCH4V TGCA 2 cut(s) 232, 243
HpyF10VI GCNNNNNNNGC 1 cut(s) 63
Hsp92II CATG 2 cut(s) 247, 257
LmnI GCTCC 1 cut(s) 95
LpnPI CCDG 6 cut(s) 39, 66, 78, 155, 203, 212
MaeI CTAG 2 cut(s) 33, 319
MaeIII GTNAC 1 cut(s) 275
MboII GAAGA 2 cut(s) 20, 307
MfeI CAATTG 1 cut(s) 238
MluCI AATT 3 cut(s) 85, 186, 238
MlyI GAGTC 1 cut(s) 215
MnlI CCTC 1 cut(s) 36
MslI CAYNNNNRTG 1 cut(s) 273
MspR9I CCNGG 1 cut(s) 54
MunI CAATTG 1 cut(s) 238
Mva1269I GAATGC 1 cut(s) 232
MvaI CCWGG 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 63
NlaIII CATG 2 cut(s) 247, 257
NmuCI GTSAC 1 cut(s) 275
NspI RCATGY 1 cut(s) 247
PctI GAATGC 1 cut(s) 232
PleI GAGTC 1 cut(s) 215
PpsI GAGTC 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PspPI GGNCC 2 cut(s) 23, 175
RseI CAYNNNNRTG 1 cut(s) 273
Sau96I GGNCC 2 cut(s) 23, 175
SchI GAGTC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 54
SetI ASST 3 cut(s) 100, 111, 180
SinI GGWCC 1 cut(s) 175
SmiMI CAYNNNNRTG 1 cut(s) 273
Sse9I AATT 3 cut(s) 85, 186, 238
SsiI CCGC 1 cut(s) 173
SspMI CTAG 2 cut(s) 33, 319
StyD4I CCNGG 1 cut(s) 52
StyI CCWWGG 1 cut(s) 153
TasI AATT 3 cut(s) 85, 186, 238
TseFI GTSAC 1 cut(s) 275
Tsp45I GTSAC 1 cut(s) 275
TspDTI ATGAA 1 cut(s) 270
VpaK11BI GGWCC 1 cut(s) 175
XapI RAATTY 1 cut(s) 186
XceI RCATGY 1 cut(s) 247
XspI CTAG 2 cut(s) 33, 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.