Rmu_sc0031138.1_g000001

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0031138.1
Physical Location & Seq
Reverse (-)
1 .. 470
470 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0031138.1_g000001.1.cds

Sequence Viewer

Length: 253 bp
atgaatgaactgagacaatctgatacccacataattggggtgtacggtattgggggcgtggggaagacaacgcttgctaaagaagtttatcggcaagccacagaagataaaactttatttgatgatgttgttatagtagaagatgtgaaaaagattccagatttgcatggaattcaaaaaagaattgctgaaaagttgggaatggactttctcggagatgagactacagacaaaagagctagtcgtcttttta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.44

Weight (kDa)

5.61

Isoelectric Point (pI)

27.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 171
AfaI GTAC 1 cut(s) 44
AgsI TTSAA 1 cut(s) 176
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
Alw26I GTCTC 2 cut(s) 7, 215
ApoI RAATTY 1 cut(s) 171
BbsI GAAGAC 1 cut(s) 71
BcoDI GTCTC 2 cut(s) 7, 215
BfaI CTAG 1 cut(s) 240
BfmI CTRYAG 1 cut(s) 225
BpiI GAAGAC 1 cut(s) 71
BsmAI GTCTC 2 cut(s) 7, 215
Bst4CI ACNGT 1 cut(s) 47
BstC8I GCNNGC 2 cut(s) 75, 96
BstDEI CTNAG 1 cut(s) 11
BstMAI GTCTC 2 cut(s) 7, 215
BstSFI CTRYAG 1 cut(s) 225
BstV2I GAAGAC 1 cut(s) 71
BstXI CCANNNNNNTGG 1 cut(s) 35
Cac8I GCNNGC 2 cut(s) 75, 96
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 167
CviJI RGCY 2 cut(s) 98, 239
CviKI_1 RGCY 2 cut(s) 98, 239
CviQI GTAC 1 cut(s) 43
DdeI CTNAG 1 cut(s) 11
EcoRI GAATTC 1 cut(s) 171
FaeI CATG 1 cut(s) 170
FaiI YATR 3 cut(s) 32, 134, 168
FatI CATG 1 cut(s) 166
FspBI CTAG 1 cut(s) 240
Hin1II CATG 1 cut(s) 170
HinfI GANTC 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 2 cut(s) 22, 215
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 166
HpyF3I CTNAG 1 cut(s) 11
Hsp92II CATG 1 cut(s) 170
LpnPI CCDG 1 cut(s) 171
MaeI CTAG 1 cut(s) 240
MboII GAAGA 3 cut(s) 76, 116, 152
MluCI AATT 3 cut(s) 33, 171, 183
NlaIII CATG 1 cut(s) 170
PfeI GAWTC 1 cut(s) 154
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SetI ASST 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 225
SgeI CNNG 6 cut(s) 70, 86, 107, 170, 179, 224
Sse9I AATT 3 cut(s) 33, 171, 183
SspMI CTAG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 47
TasI AATT 3 cut(s) 33, 171, 183
TfiI GAWTC 1 cut(s) 154
TspDTI ATGAA 2 cut(s) 17, 21
XapI RAATTY 1 cut(s) 171
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.