Rh3BG284800

Protein SGT1 homolog At5g65490-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0018174
Physical Location & Seq
Forward (+)
28270877 .. 28274266
3390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG284800.1

Sequence Viewer

Length: 330 bp
ATGATGAGTGCTCCAGTGAGGCGCATAGATGAGATTCTTGCTTTACCTTATTCGGCGGATGATTTTAAGAGCGGAGATGTTCCACCTTCTGATGATGATTCTTGGCTTTACAATGGAGAGGATGAATTGAACTCTGAACTTCTACAGAGACAAAAGGAGATGAAACTTTATGATTTAAAACATAAGAAGCAGAAGAAGAAGTCAAAGAGCAGGACAATGTTGGTCCATCCTCCAGCTCCACCATTGATGGGAACTGGAAGATGGAGCAACCAACTGTCTTATGAATCCATAAAGGTTTATAGTCAAACGTGGAGTTCCCCATTTCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SGT1

Protein Analysis

109

Amino Acids

12.62

Weight (kDa)

7.92

Isoelectric Point (pI)

62.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SGT1 PF07093 2 - 72 6.2e-13 SGT1 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 72
AciI CCGC 2 cut(s) 56, 72
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 2 cut(s) 130, 326
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
Alw21I GWGCWC 1 cut(s) 13
Alw26I GTCTC 1 cut(s) 142
AspLEI GCGC 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 223
AvaII GGWCC 1 cut(s) 223
Bbv12I GWGCWC 1 cut(s) 13
BccI CCATC 3 cut(s) 234, 241, 255
BcoDI GTCTC 1 cut(s) 142
BfmI CTRYAG 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 223
BmgT120I GGNCC 1 cut(s) 223
BpmI CTGGAG 1 cut(s) 216
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse1I ACTGG 2 cut(s) 14, 259
BseGI GGATG 3 cut(s) 64, 127, 226
BseLI CCNNNNNNNGG 1 cut(s) 248
BseNI ACTGG 2 cut(s) 14, 259
BsiHKAI GWGCWC 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 248
BsmAI GTCTC 1 cut(s) 142
Bsp1286I GDGCHC 1 cut(s) 13
BspACI CCGC 2 cut(s) 56, 72
BsrBI CCGCTC 1 cut(s) 72
BsrI ACTGG 2 cut(s) 14, 259
Bst4CI ACNGT 1 cut(s) 276
BstF5I GGATG 3 cut(s) 64, 127, 226
BstHHI GCGC 1 cut(s) 24
BstMAI GTCTC 1 cut(s) 142
BstSFI CTRYAG 1 cut(s) 143
BtsCI GGATG 3 cut(s) 64, 127, 226
BtsIMutI CAGTG 1 cut(s) 21
CfoI GCGC 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 223
CviJI RGCY 2 cut(s) 106, 236
CviKI_1 RGCY 2 cut(s) 106, 236
DraI TTTAAA 1 cut(s) 177
EciI GGCGGA 1 cut(s) 71
Eco47I GGWCC 1 cut(s) 223
FaiI YATR 6 cut(s) 26, 171, 183, 282, 290, 300
FokI GGATG 3 cut(s) 71, 134, 213
GlaI GCGC 1 cut(s) 23
GsuI CTGGAG 1 cut(s) 216
HhaI GCGC 1 cut(s) 24
Hin6I GCGC 1 cut(s) 22
HinP1I GCGC 1 cut(s) 22
HinfI GANTC 3 cut(s) 34, 98, 284
Hpy188I TCNGA 2 cut(s) 91, 136
HpyAV CCTTC 1 cut(s) 96
HpyCH4III ACNGT 1 cut(s) 276
HpyCH4IV ACGT 1 cut(s) 308
HpySE526I ACGT 1 cut(s) 308
HspAI GCGC 1 cut(s) 22
LmnI GCTCC 3 cut(s) 16, 241, 264
LpnPI CCDG 4 cut(s) 27, 196, 240, 246
MaeII ACGT 1 cut(s) 308
MbiI CCGCTC 1 cut(s) 72
MboII GAAGA 3 cut(s) 205, 208, 270
MhlI GDGCHC 1 cut(s) 13
MluCI AATT 1 cut(s) 125
MnlI CCTC 3 cut(s) 12, 112, 240
MseI TTAA 2 cut(s) 66, 176
PfeI GAWTC 3 cut(s) 34, 98, 284
PspPI GGNCC 1 cut(s) 223
SaqAI TTAA 2 cut(s) 66, 176
Sau96I GGNCC 1 cut(s) 223
SduI GDGCHC 1 cut(s) 13
SetI ASST 5 cut(s) 49, 88, 238, 297, 311
SfcI CTRYAG 1 cut(s) 143
SgeI CNNG 7 cut(s) 26, 50, 114, 223, 245, 267, 321
SinI GGWCC 1 cut(s) 223
Sse9I AATT 1 cut(s) 125
SsiI CCGC 2 cut(s) 56, 72
TaaI ACNGT 1 cut(s) 276
TaiI ACGT 1 cut(s) 311
TasI AATT 1 cut(s) 125
TfiI GAWTC 3 cut(s) 34, 98, 284
Tru1I TTAA 2 cut(s) 66, 176
Tru9I TTAA 2 cut(s) 66, 176
TscAI CASTG 1 cut(s) 21
TspDTI ATGAA 3 cut(s) 138, 176, 297
TspRI CASTG 1 cut(s) 21
VpaK11BI GGWCC 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.