Rh3CG282500

Protein SGT1 homolog At5g65490-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0018174
Physical Location & Seq
Forward (+)
28430580 .. 28430870
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG282500.1

Sequence Viewer

Length: 291 bp
ATGTGTTACTTCCGCAGTGAGATGATGAGTGCTCCAGTGAGGCGCATAGATGAGATTCTTGCTTTACCTTATTCGGCGGAAGATTTTAAGAGTGTAGATGTTCCACCTTCTGATGATGATTCTTGGCTTTACAATGGAGAGGATGAATTGAACTCTGAACTTCTACAGAGACAAAAGGAGATGGAACTTTATGATTTAAAACATAAGAAGAAGAATAAGAAGTCAAAGAGCAGGACAATGTTGGTCCATCCTCCAGCTCCACCATTGATGGGTTCAATCCTGGTGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SGT1

Protein Analysis

96

Amino Acids

11.14

Weight (kDa)

5.65

Isoelectric Point (pI)

69.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SGT1 PF07093 6 - 79 6.4e-14 SGT1 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 13, 77
AfiI CCNNNNNNNGG 1 cut(s) 269
AgsI TTSAA 2 cut(s) 151, 276
AjnI CCWGG 1 cut(s) 279
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
Alw21I GWGCWC 1 cut(s) 34
Alw26I GTCTC 1 cut(s) 163
AspLEI GCGC 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 244
AvaII GGWCC 1 cut(s) 244
Bbv12I GWGCWC 1 cut(s) 34
BccI CCATC 3 cut(s) 175, 255, 262
BciT130I CCWGG 1 cut(s) 281
BcoDI GTCTC 1 cut(s) 163
BfmI CTRYAG 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 281
Bme18I GGWCC 1 cut(s) 244
BmgT120I GGNCC 1 cut(s) 244
BmrFI CCNGG 1 cut(s) 281
BpmI CTGGAG 2 cut(s) 18, 237
Bsc4I CCNNNNNNNGG 1 cut(s) 269
Bse1I ACTGG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 281
BseGI GGATG 2 cut(s) 148, 247
BseLI CCNNNNNNNGG 1 cut(s) 269
BseNI ACTGG 1 cut(s) 35
BsiHKAI GWGCWC 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 269
BsmAI GTCTC 1 cut(s) 163
Bsp1286I GDGCHC 1 cut(s) 34
BspACI CCGC 2 cut(s) 13, 77
BsrI ACTGG 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 281
BstF5I GGATG 2 cut(s) 148, 247
BstHHI GCGC 1 cut(s) 45
BstMAI GTCTC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 281
BstSCI CCNGG 1 cut(s) 279
BstSFI CTRYAG 1 cut(s) 164
BtsCI GGATG 2 cut(s) 148, 247
BtsI GCAGTG 1 cut(s) 22
BtsIMutI CAGTG 2 cut(s) 22, 42
CfoI GCGC 1 cut(s) 45
Cfr13I GGNCC 1 cut(s) 244
CviJI RGCY 2 cut(s) 127, 257
CviKI_1 RGCY 2 cut(s) 127, 257
DraI TTTAAA 1 cut(s) 198
EciI GGCGGA 1 cut(s) 92
Eco47I GGWCC 1 cut(s) 244
EcoRII CCWGG 1 cut(s) 279
FaiI YATR 4 cut(s) 47, 192, 204, 289
FokI GGATG 2 cut(s) 155, 234
GlaI GCGC 1 cut(s) 44
GsuI CTGGAG 2 cut(s) 18, 237
HhaI GCGC 1 cut(s) 45
Hin6I GCGC 1 cut(s) 43
HinP1I GCGC 1 cut(s) 43
HinfI GANTC 2 cut(s) 55, 119
Hpy188I TCNGA 2 cut(s) 112, 157
HpyAV CCTTC 1 cut(s) 117
HspAI GCGC 1 cut(s) 43
LmnI GCTCC 2 cut(s) 37, 262
LpnPI CCDG 4 cut(s) 48, 217, 266, 267
MaeIII GTNAC 1 cut(s) 5
MboII GAAGA 3 cut(s) 92, 220, 223
MhlI GDGCHC 1 cut(s) 34
MluCI AATT 1 cut(s) 146
MnlI CCTC 3 cut(s) 33, 133, 261
MseI TTAA 2 cut(s) 87, 197
MspR9I CCNGG 1 cut(s) 281
MvaI CCWGG 1 cut(s) 281
PfeI GAWTC 2 cut(s) 55, 119
Psp6I CCWGG 1 cut(s) 279
PspGI CCWGG 1 cut(s) 279
PspPI GGNCC 1 cut(s) 244
SaqAI TTAA 2 cut(s) 87, 197
Sau96I GGNCC 1 cut(s) 244
ScrFI CCNGG 1 cut(s) 281
SduI GDGCHC 1 cut(s) 34
SetI ASST 3 cut(s) 70, 109, 259
SfcI CTRYAG 1 cut(s) 164
SgeI CNNG 5 cut(s) 47, 71, 135, 244, 266
SinI GGWCC 1 cut(s) 244
Sse9I AATT 1 cut(s) 146
SsiI CCGC 2 cut(s) 13, 77
StyD4I CCNGG 1 cut(s) 279
TasI AATT 1 cut(s) 146
TfiI GAWTC 2 cut(s) 55, 119
Tru1I TTAA 2 cut(s) 87, 197
Tru9I TTAA 2 cut(s) 87, 197
TscAI CASTG 2 cut(s) 22, 42
TspDTI ATGAA 1 cut(s) 159
TspRI CASTG 2 cut(s) 22, 42
VpaK11BI GGWCC 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.