Rmu_sc0032107.1_g000001

Sigma factors are initiation factors that promote the attachment of plastid-encoded RNA polymerase (PEP) to specific initiation sites and are then released

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032107.1
Physical Location & Seq
Forward (+)
1 .. 1606
1606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032107.1_g000001.1.cds

Sequence Viewer

Length: 611 bp
gagggaagtatgggtctaatgaaaagtgttgagaaattcaaaccccaagctggttgccgatttgctacttatgcatactggtgggtgagacaaacaattaggaaggccatatttcaacattccaggactatccgcttgccggagaatgtatacaccctccttggcaaggtattggaggcaaagaaatcatatattcaggaaggaaatcacaacccaagcagagaagaattagcaagacgagttggaatgtcggttgaaaaattgggaaaattgctatattctacaagaatgcctgtttcaatgcaacaaaccgtgtgggcagaccaagataccactttccaggaggtaactgctgacactgggattgagatcccagatgtaagtgtggcaaagcagctgatgaggcaacatgtgcgcaacctcctacacactcttgaaaaaagagagaggcagataatcaggctaagatatggtattgaagatggtaagcagagatcactatcagaggttggtgagatttttggactgtccaaggaacgggtacggcaactggagagccgagcatttctgaagctcaaggaatcacttggcagccaagggcttggggctta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

23.35

Weight (kDa)

9.87

Isoelectric Point (pI)

39.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 416
AccI GTMKAC 1 cut(s) 150
AciI CCGC 1 cut(s) 133
AclWI GGATC 1 cut(s) 364
AcsI RAATTY 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 590
AfaI GTAC 1 cut(s) 543
AfiI CCNNNNNNNGG 4 cut(s) 50, 139, 166, 537
AflIII ACRYGT 1 cut(s) 409
AgsI TTSAA 6 cut(s) 40, 116, 257, 300, 437, 479
AjnI CCWGG 2 cut(s) 122, 339
AluBI AGCT 3 cut(s) 50, 397, 574
AluI AGCT 3 cut(s) 50, 397, 574
Alw26I GTCTC 1 cut(s) 82
AlwI GGATC 1 cut(s) 364
AoxI GGCC 1 cut(s) 105
ApeKI GCWGC 2 cut(s) 394, 591
ApoI RAATTY 1 cut(s) 35
AspLEI GCGC 1 cut(s) 417
AsuHPI GGTGA 2 cut(s) 97, 524
BbvI GCAGC 2 cut(s) 406, 603
BccI CCATC 1 cut(s) 476
BceAI ACGGC 1 cut(s) 560
BciT130I CCWGG 2 cut(s) 124, 341
BcoDI GTCTC 1 cut(s) 82
BisI GCNGC 2 cut(s) 395, 592
BlsI GCNGC 2 cut(s) 396, 593
Bme1390I CCNGG 2 cut(s) 124, 341
BmrFI CCNGG 2 cut(s) 124, 341
BmrI ACTGGG 1 cut(s) 369
BmuI ACTGGG 1 cut(s) 369
BpmI CTGGAG 1 cut(s) 572
BpuEI CTTGAG 1 cut(s) 560
BsaBI GATNNNNATC 2 cut(s) 368, 499
BsaJI CCNNGG 3 cut(s) 160, 531, 595
Bsc4I CCNNNNNNNGG 4 cut(s) 50, 139, 166, 537
Bse1I ACTGG 3 cut(s) 83, 364, 555
Bse8I GATNNNNATC 2 cut(s) 368, 499
BseBI CCWGG 2 cut(s) 124, 341
BseDI CCNNGG 3 cut(s) 160, 531, 595
BseJI GATNNNNATC 2 cut(s) 368, 499
BseLI CCNNNNNNNGG 4 cut(s) 50, 139, 166, 537
BseNI ACTGG 3 cut(s) 83, 364, 555
BseXI GCAGC 2 cut(s) 406, 603
BshFI GGCC 1 cut(s) 107
BsiSI CCGG 1 cut(s) 140
BslI CCNNNNNNNGG 4 cut(s) 50, 139, 166, 537
BsmAI GTCTC 1 cut(s) 82
BsmI GAATGC 1 cut(s) 294
BsnI GGCC 1 cut(s) 107
Bsp143I GATC 2 cut(s) 369, 494
BspACI CCGC 1 cut(s) 133
BspANI GGCC 1 cut(s) 107
BspPI GGATC 1 cut(s) 364
BsrI ACTGG 3 cut(s) 83, 364, 555
BssECI CCNNGG 3 cut(s) 160, 531, 595
BssMI GATC 2 cut(s) 369, 494
BssNAI GTATAC 1 cut(s) 151
BssT1I CCWWGG 3 cut(s) 160, 531, 595
Bst1107I GTATAC 1 cut(s) 151
Bst2UI CCWGG 2 cut(s) 124, 341
Bst4CI ACNGT 2 cut(s) 313, 528
BstAPI GCANNNNNTGC 1 cut(s) 412
BstC8I GCNNGC 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 464
BstENI CCTNNNNNAGG 1 cut(s) 164
BstHHI GCGC 1 cut(s) 417
BstKTI GATC 2 cut(s) 372, 497
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 2 cut(s) 369, 494
BstMWI GCNNNNNNNGC 3 cut(s) 71, 403, 412
BstNI CCWGG 2 cut(s) 124, 341
BstNSI RCATGY 1 cut(s) 413
BstSCI CCNGG 2 cut(s) 122, 339
BstV1I GCAGC 2 cut(s) 406, 603
BstX2I RGATCY 1 cut(s) 369
BstXI CCANNNNNNTGG 1 cut(s) 602
BstYI RGATCY 1 cut(s) 369
BstZ17I GTATAC 1 cut(s) 151
BsuRI GGCC 1 cut(s) 107
BtsIMutI CAGTG 1 cut(s) 357
Cac8I GCNNGC 1 cut(s) 137
CfoI GCGC 1 cut(s) 417
Csp6I GTAC 1 cut(s) 542
CspCI CAANNNNNGTGG 2 cut(s) 296, 331
CviAII CATG 1 cut(s) 410
CviJI RGCY 9 cut(s) 50, 107, 397, 463, 558, 574, 594, 601, 608
CviKI_1 RGCY 9 cut(s) 50, 107, 397, 463, 558, 574, 594, 601, 608
CviQI GTAC 1 cut(s) 542
DdeI CTNAG 1 cut(s) 464
DpnI GATC 2 cut(s) 371, 496
DpnII GATC 2 cut(s) 369, 494
Eco130I CCWWGG 3 cut(s) 160, 531, 595
Eco57I CTGAAG 1 cut(s) 590
EcoNI CCTNNNNNAGG 1 cut(s) 164
EcoRII CCWGG 2 cut(s) 122, 339
EcoT14I CCWWGG 3 cut(s) 160, 531, 595
EcoT22I ATGCAT 1 cut(s) 76
ErhI CCWWGG 3 cut(s) 160, 531, 595
FaeI CATG 1 cut(s) 413
FatI CATG 1 cut(s) 409
FblI GTMKAC 1 cut(s) 150
Fnu4HI GCNGC 2 cut(s) 395, 592
Fsp4HI GCNGC 2 cut(s) 395, 592
FspI TGCGCA 1 cut(s) 416
GlaI GCGC 1 cut(s) 416
GluI GCNGC 2 cut(s) 395, 592
GsuI CTGGAG 1 cut(s) 572
HaeIII GGCC 1 cut(s) 107
HapII CCGG 1 cut(s) 140
HhaI GCGC 1 cut(s) 417
Hin1II CATG 1 cut(s) 413
Hin6I GCGC 1 cut(s) 415
HinP1I GCGC 1 cut(s) 415
HinfI GANTC 1 cut(s) 581
HpaII CCGG 1 cut(s) 140
HphI GGTGA 2 cut(s) 97, 524
Hpy166II GTNNAC 1 cut(s) 151
Hpy188I TCNGA 2 cut(s) 505, 570
Hpy188III TCNNGA 2 cut(s) 197, 434
Hpy8I GTNNAC 1 cut(s) 151
HpyAV CCTTC 2 cut(s) 97, 194
HpyCH4III ACNGT 2 cut(s) 313, 528
HpyCH4V TGCA 2 cut(s) 74, 304
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 403, 412
HpyF3I CTNAG 1 cut(s) 464
Hsp92II CATG 1 cut(s) 413
HspAI GCGC 1 cut(s) 415
Kzo9I GATC 2 cut(s) 369, 494
Lsp1109I GCAGC 2 cut(s) 406, 603
MaeIII GTNAC 1 cut(s) 346
MalI GATC 2 cut(s) 371, 496
MboI GATC 2 cut(s) 369, 494
MboII GAAGA 2 cut(s) 236, 491
MflI RGATCY 1 cut(s) 369
MluCI AATT 5 cut(s) 35, 96, 227, 260, 269
MmeI TCCRAC 1 cut(s) 223
MnlI CCTC 7 cut(s) 167, 169, 337, 396, 431, 441, 499
Mph1103I ATGCAT 1 cut(s) 76
MslI CAYNNNNRTG 1 cut(s) 79
MspA1I CMGCKG 1 cut(s) 397
MspI CCGG 1 cut(s) 140
MspR9I CCNGG 2 cut(s) 124, 341
Mva1269I GAATGC 1 cut(s) 294
MvaI CCWGG 2 cut(s) 124, 341
MwoI GCNNNNNNNGC 3 cut(s) 71, 403, 412
NdeII GATC 2 cut(s) 369, 494
NlaIII CATG 1 cut(s) 413
NmeAIII GCCGAG 1 cut(s) 584
NsbI TGCGCA 1 cut(s) 416
NsiI ATGCAT 1 cut(s) 76
NspI RCATGY 1 cut(s) 413
PciI ACATGT 1 cut(s) 409
PctI GAATGC 1 cut(s) 294
PfeI GAWTC 1 cut(s) 581
PfoI TCCNGGA 2 cut(s) 122, 339
PkrI GCNGC 2 cut(s) 396, 593
PscI ACATGT 1 cut(s) 409
Psp6I CCWGG 2 cut(s) 122, 339
PspGI CCWGG 2 cut(s) 122, 339
PsuI RGATCY 1 cut(s) 369
PvuII CAGCTG 1 cut(s) 397
RsaI GTAC 1 cut(s) 543
RsaNI GTAC 1 cut(s) 542
RseI CAYNNNNRTG 1 cut(s) 79
SatI GCNGC 2 cut(s) 395, 592
Sau3AI GATC 2 cut(s) 369, 494
ScrFI CCNGG 2 cut(s) 124, 341
SetI ASST 7 cut(s) 52, 171, 348, 399, 423, 510, 576
SmiMI CAYNNNNRTG 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 575
SmoI CTYRAG 1 cut(s) 575
Sse9I AATT 5 cut(s) 35, 96, 227, 260, 269
SsiI CCGC 1 cut(s) 133
StyD4I CCNGG 2 cut(s) 122, 339
StyI CCWWGG 3 cut(s) 160, 531, 595
TaaI ACNGT 2 cut(s) 313, 528
TasI AATT 5 cut(s) 35, 96, 227, 260, 269
TfiI GAWTC 1 cut(s) 581
TscAI CASTG 1 cut(s) 364
TseI GCWGC 2 cut(s) 394, 591
TspDTI ATGAA 1 cut(s) 35
TspRI CASTG 1 cut(s) 364
XagI CCTNNNNNAGG 1 cut(s) 164
XapI RAATTY 1 cut(s) 35
XceI RCATGY 1 cut(s) 413
XmiI GTMKAC 1 cut(s) 150
Zsp2I ATGCAT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.