Rmu_sc0032990.1_g000001

Chaperone protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032990.1
Physical Location & Seq
Reverse (-)
596 .. 1245
650 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032990.1_g000001.1.cds

Sequence Viewer

Length: 534 bp
atggaggccgaaaacgggccagcgtcttattacagtattctgggtgttaattcagagtcttctatggaagaaattaagcgcgcttatcggaaacttgccatgcagtatcatccagacaggtggacgcgaagcccttctttgctgggcgaagccaagcggaggttccaggagattcaagaagcctattcggtgttatcggatcagaggaagcgaacaatgtacgacgcaggcttatatgatcctgatgatgaagaggacgaggggttgtgtgactttgtgcaagaattggtgtctctaatggcggaatcgagacgagagcagaagagttatagcttggaggatttgcaggacatgttcatggacatggttcaaggattcgagccatcttttacattctgtgggccgtccaaggctaattttgagcacgctcaatctgggtgcgcaaagaggacgcgtctggaatctaagaatgtaagtgtcgacacaggctcggctatagggatgtatggaggaccaggattcttttcattttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

177

Amino Acids

20.15

Weight (kDa)

4.75

Isoelectric Point (pI)

62.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015610)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 442
AccI GTMKAC 1 cut(s) 480
AccII CGCG 3 cut(s) 81, 127, 454
AciI CCGC 2 cut(s) 157, 302
AclWI GGATC 2 cut(s) 207, 233
AfaI GTAC 1 cut(s) 221
AfiI CCNNNNNNNGG 2 cut(s) 15, 159
AflIII ACRYGT 2 cut(s) 351, 452
AgsI TTSAA 2 cut(s) 176, 371
AjnI CCWGG 2 cut(s) 165, 514
AjuI GAANNNNNNNTTGG 2 cut(s) 146, 178
AluBI AGCT 1 cut(s) 333
AluI AGCT 1 cut(s) 333
Alw21I GWGCWC 1 cut(s) 426
Alw26I GTCTC 2 cut(s) 297, 304
AlwI GGATC 2 cut(s) 207, 233
AoxI GGCC 3 cut(s) 6, 17, 401
Asp700I GAANNNNTTC 1 cut(s) 133
AspLEI GCGC 3 cut(s) 81, 83, 443
AspS9I GGNCC 3 cut(s) 17, 401, 512
AvaII GGWCC 1 cut(s) 512
BbsI GAAGAC 1 cut(s) 51
Bbv12I GWGCWC 1 cut(s) 426
BccI CCATC 1 cut(s) 391
BceAI ACGGC 1 cut(s) 388
BciT130I CCWGG 2 cut(s) 167, 516
BcoDI GTCTC 2 cut(s) 297, 304
BfmI CTRYAG 1 cut(s) 495
Bme1390I CCNGG 2 cut(s) 167, 516
Bme18I GGWCC 1 cut(s) 512
BmgT120I GGNCC 3 cut(s) 17, 401, 512
BmiI GGNNCC 1 cut(s) 164
BmrFI CCNGG 2 cut(s) 167, 516
BpiI GAAGAC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 408
Bsc4I CCNNNNNNNGG 2 cut(s) 15, 159
BseBI CCWGG 2 cut(s) 167, 516
BseDI CCNNGG 1 cut(s) 408
BseGI GGATG 2 cut(s) 109, 507
BseLI CCNNNNNNNGG 2 cut(s) 15, 159
BsePI GCGCGC 1 cut(s) 79
BseYI CCCAGC 1 cut(s) 142
Bsh1236I CGCG 3 cut(s) 81, 127, 454
BshFI GGCC 3 cut(s) 8, 19, 403
BsiHKAI GWGCWC 1 cut(s) 426
BslI CCNNNNNNNGG 2 cut(s) 15, 159
BsmAI GTCTC 2 cut(s) 297, 304
BsmBI CGTCTC 1 cut(s) 304
BsnI GGCC 3 cut(s) 8, 19, 403
Bsp1286I GDGCHC 1 cut(s) 426
Bsp143I GATC 2 cut(s) 199, 238
BspACI CCGC 2 cut(s) 157, 302
BspANI GGCC 3 cut(s) 8, 19, 403
BspFNI CGCG 3 cut(s) 81, 127, 454
BspLI GGNNCC 1 cut(s) 164
BspPI GGATC 2 cut(s) 207, 233
BssECI CCNNGG 1 cut(s) 408
BssHII GCGCGC 1 cut(s) 79
BssMI GATC 2 cut(s) 199, 238
BssT1I CCWWGG 1 cut(s) 408
Bst2UI CCWGG 2 cut(s) 167, 516
Bst4CI ACNGT 1 cut(s) 35
Bst6I CTCTTC 2 cut(s) 246, 317
BstC8I GCNNGC 4 cut(s) 21, 81, 229, 426
BstDEI CTNAG 1 cut(s) 465
BstF5I GGATG 2 cut(s) 109, 507
BstFNI CGCG 3 cut(s) 81, 127, 454
BstHHI GCGC 3 cut(s) 81, 83, 443
BstKTI GATC 2 cut(s) 202, 241
BstMAI GTCTC 2 cut(s) 297, 304
BstMBI GATC 2 cut(s) 199, 238
BstNI CCWGG 2 cut(s) 167, 516
BstNSI RCATGY 1 cut(s) 355
BstSCI CCNGG 2 cut(s) 165, 514
BstSFI CTRYAG 1 cut(s) 495
BstUI CGCG 3 cut(s) 81, 127, 454
BstV2I GAAGAC 1 cut(s) 51
BstXI CCANNNNNNTGG 1 cut(s) 120
BsuRI GGCC 3 cut(s) 8, 19, 403
BtsCI GGATG 2 cut(s) 109, 507
Cac8I GCNNGC 4 cut(s) 21, 81, 229, 426
CfoI GCGC 3 cut(s) 81, 83, 443
Cfr13I GGNCC 3 cut(s) 17, 401, 512
CseI GACGC 5 cut(s) 12, 133, 233, 443, 460
Csp6I GTAC 1 cut(s) 220
CviAII CATG 4 cut(s) 100, 352, 358, 364
CviQI GTAC 1 cut(s) 220
DdeI CTNAG 1 cut(s) 465
DpnI GATC 2 cut(s) 201, 240
DpnII GATC 2 cut(s) 199, 238
Eam1104I CTCTTC 2 cut(s) 246, 317
EarI CTCTTC 2 cut(s) 246, 317
EciI GGCGGA 1 cut(s) 317
Eco130I CCWWGG 1 cut(s) 408
Eco47I GGWCC 1 cut(s) 512
EcoRII CCWGG 2 cut(s) 165, 514
EcoT14I CCWWGG 1 cut(s) 408
ErhI CCWWGG 1 cut(s) 408
Esp3I CGTCTC 1 cut(s) 304
FaeI CATG 4 cut(s) 103, 355, 361, 367
FalI AAGNNNNNCTT 2 cut(s) 121, 153
FatI CATG 4 cut(s) 99, 351, 357, 363
FblI GTMKAC 1 cut(s) 480
FokI GGATG 2 cut(s) 96, 514
FspI TGCGCA 1 cut(s) 442
GlaI GCGC 3 cut(s) 80, 82, 442
GsaI CCCAGC 1 cut(s) 146
HaeIII GGCC 3 cut(s) 8, 19, 403
HgaI GACGC 5 cut(s) 12, 133, 233, 443, 460
HhaI GCGC 3 cut(s) 81, 83, 443
Hin1II CATG 4 cut(s) 103, 355, 361, 367
Hin6I GCGC 3 cut(s) 79, 81, 441
HinP1I GCGC 3 cut(s) 79, 81, 441
HincII GTYRAC 1 cut(s) 481
HindII GTYRAC 1 cut(s) 481
HinfI GANTC 6 cut(s) 56, 172, 305, 375, 461, 519
Hpy166II GTNNAC 2 cut(s) 123, 481
Hpy188I TCNGA 4 cut(s) 55, 90, 199, 204
Hpy188III TCNNGA 5 cut(s) 113, 176, 242, 309, 458
Hpy8I GTNNAC 2 cut(s) 123, 481
Hpy99I CGWCG 1 cut(s) 227
HpyAV CCTTC 1 cut(s) 144
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 3 cut(s) 103, 280, 346
HpyF3I CTNAG 1 cut(s) 465
Hsp92II CATG 4 cut(s) 103, 355, 361, 367
HspAI GCGC 3 cut(s) 79, 81, 441
Kzo9I GATC 2 cut(s) 199, 238
MaeIII GTNAC 1 cut(s) 269
MalI GATC 2 cut(s) 201, 240
MboI GATC 2 cut(s) 199, 238
MboII GAAGA 4 cut(s) 51, 80, 263, 334
MhlI GDGCHC 1 cut(s) 426
MluCI AATT 4 cut(s) 49, 72, 284, 415
MluI ACGCGT 1 cut(s) 452
MlyI GAGTC 1 cut(s) 65
MnlI CCTC 7 cut(s) 153, 198, 247, 253, 331, 441, 503
MroXI GAANNNNTTC 1 cut(s) 133
MseI TTAA 2 cut(s) 48, 75
MslI CAYNNNNRTG 2 cut(s) 356, 362
MspR9I CCNGG 2 cut(s) 167, 516
MvaI CCWGG 2 cut(s) 167, 516
MvnI CGCG 3 cut(s) 81, 127, 454
NdeII GATC 2 cut(s) 199, 238
NlaIII CATG 4 cut(s) 103, 355, 361, 367
NlaIV GGNNCC 1 cut(s) 164
NmeAIII GCCGAG 1 cut(s) 470
NmuCI GTSAC 1 cut(s) 269
NsbI TGCGCA 1 cut(s) 442
NspI RCATGY 1 cut(s) 355
PauI GCGCGC 1 cut(s) 79
PciI ACATGT 1 cut(s) 351
PdmI GAANNNNTTC 1 cut(s) 133
PfeI GAWTC 5 cut(s) 172, 305, 375, 461, 519
PfoI TCCNGGA 1 cut(s) 165
PleI GAGTC 1 cut(s) 64
PpsI GAGTC 1 cut(s) 64
PscI ACATGT 1 cut(s) 351
Psp6I CCWGG 2 cut(s) 165, 514
PspFI CCCAGC 1 cut(s) 142
PspGI CCWGG 2 cut(s) 165, 514
PspN4I GGNNCC 1 cut(s) 164
PspPI GGNCC 3 cut(s) 17, 401, 512
PteI GCGCGC 1 cut(s) 79
RsaI GTAC 1 cut(s) 221
RsaNI GTAC 1 cut(s) 220
RseI CAYNNNNRTG 2 cut(s) 356, 362
SalI GTCGAC 1 cut(s) 479
SaqAI TTAA 2 cut(s) 48, 75
Sau3AI GATC 2 cut(s) 199, 238
Sau96I GGNCC 3 cut(s) 17, 401, 512
SchI GAGTC 1 cut(s) 65
ScrFI CCNGG 2 cut(s) 167, 516
SduI GDGCHC 1 cut(s) 426
SetI ASST 3 cut(s) 122, 164, 335
SfcI CTRYAG 1 cut(s) 495
SinI GGWCC 1 cut(s) 512
SmiMI CAYNNNNRTG 2 cut(s) 356, 362
Sse9I AATT 4 cut(s) 49, 72, 284, 415
SsiI CCGC 2 cut(s) 157, 302
StyD4I CCNGG 2 cut(s) 165, 514
StyI CCWWGG 1 cut(s) 408
TaaI ACNGT 1 cut(s) 35
TaqI TCGA 3 cut(s) 308, 378, 480
TasI AATT 4 cut(s) 49, 72, 284, 415
TfiI GAWTC 5 cut(s) 172, 305, 375, 461, 519
Tru1I TTAA 2 cut(s) 48, 75
Tru9I TTAA 2 cut(s) 48, 75
TseFI GTSAC 1 cut(s) 269
Tsp45I GTSAC 1 cut(s) 269
TspDTI ATGAA 3 cut(s) 264, 346, 516
VpaK11BI GGWCC 1 cut(s) 512
XceI RCATGY 1 cut(s) 355
XmiI GTMKAC 1 cut(s) 480
XmnI GAANNNNTTC 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.