Rmu_sc0033380.1_g000001

VQ motif

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033380.1
Physical Location & Seq
Reverse (-)
2 .. 308
307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033380.1_g000001.1.cds

Sequence Viewer

Length: 307 bp
atggagcaacttagaaaccgcgaaaatcgtcagcagagagctgagaggcaaaagaggagcaaagctgaaacacccattatgatcaagtatatttccagccctatgatggttcaagccaacaatgcttcagagttcagagcaattgttcaggaactcacgggccaaaattctgacactaccattccagatcatggaacaaaccaagcaagctgggtttctaaccataaagcttcacaatcagcaaatatgaaaacccaaaacgccgatgagctgatgaagttttcagatgaccgtgtagaagttttca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.73

Weight (kDa)

8.11

Isoelectric Point (pI)

33.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015643)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 191
AccII CGCG 1 cut(s) 21
AciI CCGC 1 cut(s) 19
AcsI RAATTY 1 cut(s) 166
AcuI CTGAAG 1 cut(s) 111
AfiI CCNNNNNNNGG 2 cut(s) 106, 191
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 5 cut(s) 41, 65, 210, 230, 271
AluI AGCT 5 cut(s) 41, 65, 210, 230, 271
AoxI GGCC 1 cut(s) 160
ApoI RAATTY 1 cut(s) 166
AspS9I GGNCC 1 cut(s) 160
BccI CCATC 1 cut(s) 100
BclI TGATCA 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 160
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 191
BseLI CCNNNNNNNGG 2 cut(s) 106, 191
BseMII CTCAG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 70
BseYI CCCAGC 1 cut(s) 210
Bsh1236I CGCG 1 cut(s) 21
BshFI GGCC 1 cut(s) 162
BslI CCNNNNNNNGG 2 cut(s) 106, 191
BsnI GGCC 1 cut(s) 162
Bsp143I GATC 2 cut(s) 81, 187
BspACI CCGC 1 cut(s) 19
BspANI GGCC 1 cut(s) 162
BspCNI CTCAG 1 cut(s) 34
BspFNI CGCG 1 cut(s) 21
BssMI GATC 2 cut(s) 81, 187
Bst4CI ACNGT 1 cut(s) 293
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 2 cut(s) 11, 42
BstFNI CGCG 1 cut(s) 21
BstKTI GATC 2 cut(s) 84, 190
BstMBI GATC 2 cut(s) 81, 187
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstUI CGCG 1 cut(s) 21
BsuRI GGCC 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 160
CviAII CATG 1 cut(s) 191
CviJI RGCY 8 cut(s) 41, 65, 99, 116, 162, 210, 230, 271
CviKI_1 RGCY 8 cut(s) 41, 65, 99, 116, 162, 210, 230, 271
DdeI CTNAG 2 cut(s) 11, 42
DpnI GATC 2 cut(s) 83, 189
DpnII GATC 2 cut(s) 81, 187
Eco57I CTGAAG 1 cut(s) 111
FaeI CATG 1 cut(s) 194
FaiI YATR 6 cut(s) 80, 90, 104, 192, 225, 248
FatI CATG 1 cut(s) 190
FbaI TGATCA 1 cut(s) 81
GsaI CCCAGC 1 cut(s) 214
HaeIII GGCC 1 cut(s) 162
Hin1II CATG 1 cut(s) 194
HindIII AAGCTT 1 cut(s) 228
Hpy188I TCNGA 4 cut(s) 130, 137, 172, 286
Hpy188III TCNNGA 2 cut(s) 149, 185
HpyCH4III ACNGT 1 cut(s) 293
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 11, 42
Hsp92II CATG 1 cut(s) 194
Ksp22I TGATCA 1 cut(s) 81
Kzo9I GATC 2 cut(s) 81, 187
LmnI GCTCC 2 cut(s) 4, 57
LpnPI CCDG 4 cut(s) 109, 134, 196, 198
MalI GATC 2 cut(s) 83, 189
MboI GATC 2 cut(s) 81, 187
MfeI CAATTG 1 cut(s) 141
MluCI AATT 2 cut(s) 141, 166
MnlI CCTC 2 cut(s) 39, 48
MunI CAATTG 1 cut(s) 141
MvnI CGCG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeII GATC 2 cut(s) 81, 187
NlaIII CATG 1 cut(s) 194
PflMI CCANNNNNTGG 1 cut(s) 191
PspFI CCCAGC 1 cut(s) 210
PspPI GGNCC 1 cut(s) 160
Sau3AI GATC 2 cut(s) 81, 187
Sau96I GGNCC 1 cut(s) 160
SetI ASST 5 cut(s) 43, 67, 212, 232, 273
Sse9I AATT 2 cut(s) 141, 166
SsiI CCGC 1 cut(s) 19
TaaI ACNGT 1 cut(s) 293
TasI AATT 2 cut(s) 141, 166
TspDTI ATGAA 2 cut(s) 263, 290
Van91I CCANNNNNTGG 1 cut(s) 191
XapI RAATTY 1 cut(s) 166
XcmI CCANNNNNNNNNTGG 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.