Rw3G002120

VQ motif

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Forward (+)
1885063 .. 1885449
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G002120.1

Sequence Viewer

Length: 387 bp
ATGGAGCAACTTAGAAACCGCGAAAATCGTCAGCAGAGAGCTGAGAGGCAAAAGAGGAGCAAAGCTGAAACACCCATTATGATCAAGTATATTTCCAGCCCTATGATGGTTCAAGCCAACAATGCTTCAGAGTTCAGAGCAATTGTTCAGGAACTCACAGGCCAAAATTCTGACACTACCATTCCAGATCATGGAACAAACCAAGCAAGCTGGGTTTCTAACCATAGAGCTTCACAATCAGCAAATATGAAAACCCAAAACGCCGATGAGCTGATGAAGTTTTCAGATGACCGTGTAGAAGTTTTCAGTCAGTTTGATGAAATTAAGTTCTGGAGGGAAGTTTCAGAGAGCTTCTGCGCTTCCGAATCTCCATATGGTTATGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.8

Weight (kDa)

5.71

Isoelectric Point (pI)

39.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
VQ PF05678 31 - 58 7.7e-09 VQ motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015643)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 191
AccII CGCG 1 cut(s) 21
AciI CCGC 1 cut(s) 19
AcsI RAATTY 1 cut(s) 166
AcuI CTGAAG 1 cut(s) 111
AfiI CCNNNNNNNGG 2 cut(s) 106, 191
AgsI TTSAA 1 cut(s) 113
AluBI AGCT 6 cut(s) 41, 65, 210, 230, 271, 351
AluI AGCT 6 cut(s) 41, 65, 210, 230, 271, 351
AoxI GGCC 1 cut(s) 160
ApoI RAATTY 1 cut(s) 166
AspLEI GCGC 1 cut(s) 359
BccI CCATC 1 cut(s) 100
BclI TGATCA 1 cut(s) 81
BpmI CTGGAG 1 cut(s) 352
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 191
BseLI CCNNNNNNNGG 2 cut(s) 106, 191
BseMII CTCAG 1 cut(s) 33
BseRI GAGGAG 1 cut(s) 70
BseYI CCCAGC 1 cut(s) 210
Bsh1236I CGCG 1 cut(s) 21
BshFI GGCC 1 cut(s) 162
BslI CCNNNNNNNGG 2 cut(s) 106, 191
BsnI GGCC 1 cut(s) 162
Bsp143I GATC 2 cut(s) 81, 187
BspACI CCGC 1 cut(s) 19
BspANI GGCC 1 cut(s) 162
BspCNI CTCAG 1 cut(s) 34
BspFNI CGCG 1 cut(s) 21
BssMI GATC 2 cut(s) 81, 187
Bst4CI ACNGT 1 cut(s) 293
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 2 cut(s) 11, 42
BstFNI CGCG 1 cut(s) 21
BstHHI GCGC 1 cut(s) 359
BstKTI GATC 2 cut(s) 84, 190
BstMBI GATC 2 cut(s) 81, 187
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstUI CGCG 1 cut(s) 21
BsuRI GGCC 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 208
CfoI GCGC 1 cut(s) 359
CviAII CATG 2 cut(s) 191, 384
CviJI RGCY 9 cut(s) 41, 65, 99, 116, 162, 210, 230, 271, 351
CviKI_1 RGCY 9 cut(s) 41, 65, 99, 116, 162, 210, 230, 271, 351
DdeI CTNAG 2 cut(s) 11, 42
DpnI GATC 2 cut(s) 83, 189
DpnII GATC 2 cut(s) 81, 187
Eco57I CTGAAG 1 cut(s) 111
EcoT22I ATGCAT 1 cut(s) 385
FaeI CATG 2 cut(s) 194, 387
FatI CATG 2 cut(s) 190, 383
FauNDI CATATG 1 cut(s) 373
FbaI TGATCA 1 cut(s) 81
GlaI GCGC 1 cut(s) 358
GsaI CCCAGC 1 cut(s) 214
GsuI CTGGAG 1 cut(s) 352
HaeIII GGCC 1 cut(s) 162
HhaI GCGC 1 cut(s) 359
Hin1II CATG 2 cut(s) 194, 387
Hin6I GCGC 1 cut(s) 357
HinP1I GCGC 1 cut(s) 357
HinfI GANTC 1 cut(s) 365
Hpy188I TCNGA 6 cut(s) 130, 137, 172, 286, 346, 364
Hpy188III TCNNGA 3 cut(s) 149, 185, 331
HpyCH4III ACNGT 1 cut(s) 293
HpyCH4V TGCA 1 cut(s) 383
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 11, 42
Hsp92II CATG 2 cut(s) 194, 387
HspAI GCGC 1 cut(s) 357
Ksp22I TGATCA 1 cut(s) 81
Kzo9I GATC 2 cut(s) 81, 187
LmnI GCTCC 2 cut(s) 4, 57
LpnPI CCDG 6 cut(s) 109, 134, 144, 196, 198, 316
MalI GATC 2 cut(s) 83, 189
MboI GATC 2 cut(s) 81, 187
MfeI CAATTG 1 cut(s) 141
MluCI AATT 3 cut(s) 141, 166, 321
MnlI CCTC 3 cut(s) 39, 48, 327
Mph1103I ATGCAT 1 cut(s) 385
MseI TTAA 1 cut(s) 324
MunI CAATTG 1 cut(s) 141
MvnI CGCG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeI CATATG 1 cut(s) 373
NdeII GATC 2 cut(s) 81, 187
NlaIII CATG 2 cut(s) 194, 387
NsiI ATGCAT 1 cut(s) 385
PfeI GAWTC 1 cut(s) 365
PflMI CCANNNNNTGG 1 cut(s) 191
PspFI CCCAGC 1 cut(s) 210
SaqAI TTAA 1 cut(s) 324
Sau3AI GATC 2 cut(s) 81, 187
SetI ASST 6 cut(s) 43, 67, 212, 232, 273, 353
Sse9I AATT 3 cut(s) 141, 166, 321
SsiI CCGC 1 cut(s) 19
TaaI ACNGT 1 cut(s) 293
TasI AATT 3 cut(s) 141, 166, 321
TfiI GAWTC 1 cut(s) 365
Tru1I TTAA 1 cut(s) 324
Tru9I TTAA 1 cut(s) 324
TspDTI ATGAA 3 cut(s) 263, 290, 333
Van91I CCANNNNNTGG 1 cut(s) 191
XapI RAATTY 1 cut(s) 166
XcmI CCANNNNNNNNNTGG 1 cut(s) 103
Zsp2I ATGCAT 1 cut(s) 385
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.