Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0035802.1

Orthogroup ID

OG0011393

Physical Location & Seq

Genomic Coordinates Forward (+)

38 .. 334

Gene Structure 297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0035802.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atgtgccctagatgccagaacttgaggcttgtttatgattgccctgcagaggcttgtcaaggaaaagaacatactactcagttatgcagggcctgcacactatgcataggtaggtgtgctcagtgtggtcggtgcattaatgatagtgaatatgaggaaacattctgtctggagttgctttgctcagattgttggaagcagctactcaagtctcaggagggggaggatacagagtttgttccatccaactctgctgttctccatgaacagaatcatagcttttgtcgccacggctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0008150 GO:0009787 GO:0009788 GO:0009966 GO:0009968 GO:0010646 GO:0010648 GO:0023051 GO:0023057 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0048519 GO:0048523 GO:0048583 GO:0048585 GO:0050789 GO:0050794 GO:0065007 GO:1901419 GO:1901420 GO:1905957 GO:1905958

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like

Protein Analysis

98

Amino Acids

11.14

Weight (kDa)

5.24

Isoelectric Point (pI)

51.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011393)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G26000
fragaria_vesca	FvH4_4g24590
malus_domestica	MD13G1110000.v1.1 MD16G1109900.v1.1
prunus_persica	Prupe.1G234900_v2.0.a1
pyrus_communis	pycom13g09570 pycom16g09340
rosa_chinensis	RchiOBHm_Chr4g0431591
rosa_laevigata	RLG00000006905
rosa_multiflora	Rmu_sc0008423.1_g000001 Rmu_sc0035802.1_g000001 Rmu_sc0035803.1_g000001 Rmu_ssc0000203.1_g000001
rosa_roxburghii	Rroxscaffold_5G00373050
rosa_rugosa	Rorug04G0251100
rosa_samantha	Rh4AG307800 Rh4BG315400 Rh4CG330900 Rh4DG310300
rosa_wichuraiana	Rw4G026680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	49
AluBI	AGCT	2 cut(s)	202, 279
AluI	AGCT	2 cut(s)	202, 279
Alw21I	GWGCWC	1 cut(s)	121
Alw26I	GTCTC	1 cut(s)	216
AlwNI	CAGNNNCTG	1 cut(s)	93
AoxI	GGCC	1 cut(s)	90
ApeKI	GCWGC	1 cut(s)	199
AseI	ATTAAT	1 cut(s)	138
AspS9I	GGNCC	1 cut(s)	90
BaeGI	GKGCMC	1 cut(s)	8
Bbv12I	GWGCWC	1 cut(s)	121
BbvI	GCAGC	1 cut(s)	211
BccI	CCATC	1 cut(s)	250
BciVI	GTATCC	1 cut(s)	220
BcoDI	GTCTC	1 cut(s)	216
BfaI	CTAG	2 cut(s)	9, 295
BfmI	CTRYAG	1 cut(s)	45
BfuI	GTATCC	1 cut(s)	220
BisI	GCNGC	1 cut(s)	200
BlsI	GCNGC	1 cut(s)	201
BmgT120I	GGNCC	1 cut(s)	90
BmsI	GCATC	1 cut(s)	2
BpmI	CTGGAG	1 cut(s)	191
BpuEI	CTTGAG	2 cut(s)	43, 191
BsaJI	CCNNGG	1 cut(s)	289
Bsc4I	CCNNNNNNNGG	1 cut(s)	49
BseDI	CCNNGG	1 cut(s)	289
BseGI	GGATG	1 cut(s)	242
BseLI	CCNNNNNNNGG	1 cut(s)	49
BseMII	CTCAG	4 cut(s)	92, 134, 198, 227
BseSI	GKGCMC	1 cut(s)	8
BseXI	GCAGC	1 cut(s)	211
BsgI	GTGCAG	1 cut(s)	79
BshFI	GGCC	1 cut(s)	92
BsiHKAI	GWGCWC	1 cut(s)	121
BslI	CCNNNNNNNGG	1 cut(s)	49
BsmAI	GTCTC	1 cut(s)	216
BsnI	GGCC	1 cut(s)	92
Bsp1286I	GDGCHC	2 cut(s)	8, 121
BspANI	GGCC	1 cut(s)	92
BspCNI	CTCAG	4 cut(s)	91, 133, 197, 226
BspMAI	CTGCAG	1 cut(s)	49
BssECI	CCNNGG	1 cut(s)	289
BstAPI	GCANNNNNTGC	2 cut(s)	93, 102
BstC8I	GCNNGC	1 cut(s)	94
BstDEI	CTNAG	4 cut(s)	78, 120, 184, 213
BstDSI	CCRYGG	1 cut(s)	289
BstF5I	GGATG	1 cut(s)	242
BstMAI	GTCTC	1 cut(s)	216
BstMWI	GCNNNNNNNGC	4 cut(s)	12, 93, 102, 285
BstSFI	CTRYAG	1 cut(s)	45
BstSLI	GKGCMC	1 cut(s)	8
BstV1I	GCAGC	1 cut(s)	211
BsuI	GTATCC	1 cut(s)	220
BsuRI	GGCC	1 cut(s)	92
BtgI	CCRYGG	1 cut(s)	289
BtsCI	GGATG	1 cut(s)	242
BtsIMutI	CAGTG	1 cut(s)	128
Cac8I	GCNNGC	1 cut(s)	94
CaiI	CAGNNNCTG	1 cut(s)	93
Cfr13I	GGNCC	1 cut(s)	90
CviAII	CATG	1 cut(s)	263
CviJI	RGCY	6 cut(s)	28, 53, 92, 202, 279, 294
CviKI_1	RGCY	6 cut(s)	28, 53, 92, 202, 279, 294
DdeI	CTNAG	4 cut(s)	78, 120, 184, 213
EcoO109I	RGGNCCY	1 cut(s)	90
EcoT22I	ATGCAT	1 cut(s)	107
FaeI	CATG	1 cut(s)	266
FaiI	YATR	8 cut(s)	36, 72, 85, 103, 107, 153, 264, 276
FatI	CATG	1 cut(s)	262
Fnu4HI	GCNGC	1 cut(s)	200
FokI	GGATG	1 cut(s)	229
Fsp4HI	GCNGC	1 cut(s)	200
FspBI	CTAG	2 cut(s)	9, 295
GluI	GCNGC	1 cut(s)	200
GsuI	CTGGAG	1 cut(s)	191
HaeIII	GGCC	1 cut(s)	92
Hin1II	CATG	1 cut(s)	266
HinfI	GANTC	1 cut(s)	271
Hpy188I	TCNGA	1 cut(s)	187
Hpy188III	TCNNGA	2 cut(s)	170, 215
HpyCH4V	TGCA	5 cut(s)	47, 87, 96, 105, 135
HpyF10VI	GCNNNNNNNGC	4 cut(s)	12, 93, 102, 285
HpyF3I	CTNAG	4 cut(s)	78, 120, 184, 213
Hsp92II	CATG	1 cut(s)	266
LpnPI	CCDG	6 cut(s)	29, 57, 73, 106, 155, 200
Lsp1109I	GCAGC	1 cut(s)	211
LweI	GCATC	1 cut(s)	2
MaeI	CTAG	2 cut(s)	9, 295
MhlI	GDGCHC	2 cut(s)	8, 121
MmeI	TCCRAC	2 cut(s)	173, 270
MnlI	CCTC	5 cut(s)	18, 43, 148, 211, 217
Mph1103I	ATGCAT	1 cut(s)	107
MseI	TTAA	1 cut(s)	138
MwoI	GCNNNNNNNGC	4 cut(s)	12, 93, 102, 285
NlaIII	CATG	1 cut(s)	266
NsiI	ATGCAT	1 cut(s)	107
PfeI	GAWTC	1 cut(s)	271
PkrI	GCNGC	1 cut(s)	201
PshBI	ATTAAT	1 cut(s)	138
PspPI	GGNCC	1 cut(s)	90
PstI	CTGCAG	1 cut(s)	49
PstNI	CAGNNNCTG	1 cut(s)	93
SaqAI	TTAA	1 cut(s)	138
SatI	GCNGC	1 cut(s)	200
Sau96I	GGNCC	1 cut(s)	90
SduI	GDGCHC	2 cut(s)	8, 121
SetI	ASST	4 cut(s)	112, 116, 204, 281
SfaNI	GCATC	1 cut(s)	2
SfcI	CTRYAG	1 cut(s)	45
SmlI	CTYRAG	2 cut(s)	22, 206
SmoI	CTYRAG	2 cut(s)	22, 206
SspMI	CTAG	2 cut(s)	9, 295
TfiI	GAWTC	1 cut(s)	271
Tru1I	TTAA	1 cut(s)	138
Tru9I	TTAA	1 cut(s)	138
TscAI	CASTG	1 cut(s)	128
TseI	GCWGC	1 cut(s)	199
TspDTI	ATGAA	1 cut(s)	279
TspRI	CASTG	1 cut(s)	128
VspI	ATTAAT	1 cut(s)	138
XspI	CTAG	2 cut(s)	9, 295
Zsp2I	ATGCAT	1 cut(s)	107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.