Rmu_sc0035803.1_g000001

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035803.1
Physical Location & Seq
Forward (+)
38 .. 334
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035803.1_g000001.1.cds

Sequence Viewer

Length: 297 bp
atgtgccctagatgccagaacttgaggcttgtttatgattgccccgcagaggcttgtcaaggaaaagaacatactactcagttatgcagggcctgcacactatgcataggtaggtgtgctcagtgcggtcggtgcattaatgatagtgaatatgaggaaacattctgtctggagttgctttgctcagattgttggaagcagctactcaagtctcaggagggggaggatacagagtttgttccatccaactctgctgttctccatgaacagaatcatagcttttgtcgccacggctag

Protein Analysis

98

Amino Acids

11.14

Weight (kDa)

5.24

Isoelectric Point (pI)

51.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 45, 126
AfiI CCNNNNNNNGG 1 cut(s) 49
AluBI AGCT 2 cut(s) 202, 279
AluI AGCT 2 cut(s) 202, 279
Alw21I GWGCWC 1 cut(s) 121
Alw26I GTCTC 1 cut(s) 216
AlwNI CAGNNNCTG 1 cut(s) 93
AoxI GGCC 1 cut(s) 90
ApeKI GCWGC 1 cut(s) 199
AseI ATTAAT 1 cut(s) 138
AspS9I GGNCC 1 cut(s) 90
BaeGI GKGCMC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 121
BbvI GCAGC 1 cut(s) 211
BccI CCATC 1 cut(s) 250
BciVI GTATCC 1 cut(s) 220
BcoDI GTCTC 1 cut(s) 216
BfaI CTAG 2 cut(s) 9, 295
BfuI GTATCC 1 cut(s) 220
BisI GCNGC 1 cut(s) 200
BlsI GCNGC 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 90
BmsI GCATC 1 cut(s) 2
BpmI CTGGAG 1 cut(s) 191
BpuEI CTTGAG 2 cut(s) 43, 191
BsaJI CCNNGG 1 cut(s) 289
Bsc4I CCNNNNNNNGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 289
BseGI GGATG 1 cut(s) 242
BseLI CCNNNNNNNGG 1 cut(s) 49
BseMII CTCAG 4 cut(s) 92, 134, 198, 227
BseSI GKGCMC 1 cut(s) 8
BseXI GCAGC 1 cut(s) 211
BsgI GTGCAG 1 cut(s) 79
Bsh1285I CGRYCG 1 cut(s) 130
BshFI GGCC 1 cut(s) 92
BsiEI CGRYCG 1 cut(s) 130
BsiHKAI GWGCWC 1 cut(s) 121
BslI CCNNNNNNNGG 1 cut(s) 49
BsmAI GTCTC 1 cut(s) 216
BsnI GGCC 1 cut(s) 92
Bsp1286I GDGCHC 2 cut(s) 8, 121
BspACI CCGC 2 cut(s) 45, 126
BspANI GGCC 1 cut(s) 92
BspCNI CTCAG 4 cut(s) 91, 133, 197, 226
BssECI CCNNGG 1 cut(s) 289
BstAPI GCANNNNNTGC 2 cut(s) 93, 102
BstC8I GCNNGC 1 cut(s) 94
BstDEI CTNAG 4 cut(s) 78, 120, 184, 213
BstDSI CCRYGG 1 cut(s) 289
BstF5I GGATG 1 cut(s) 242
BstMAI GTCTC 1 cut(s) 216
BstMCI CGRYCG 1 cut(s) 130
BstMWI GCNNNNNNNGC 5 cut(s) 12, 93, 102, 132, 285
BstSLI GKGCMC 1 cut(s) 8
BstV1I GCAGC 1 cut(s) 211
BsuI GTATCC 1 cut(s) 220
BsuRI GGCC 1 cut(s) 92
BtgI CCRYGG 1 cut(s) 289
BtsCI GGATG 1 cut(s) 242
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 94
CaiI CAGNNNCTG 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 90
CviAII CATG 1 cut(s) 263
CviJI RGCY 6 cut(s) 28, 53, 92, 202, 279, 294
CviKI_1 RGCY 6 cut(s) 28, 53, 92, 202, 279, 294
DdeI CTNAG 4 cut(s) 78, 120, 184, 213
EcoO109I RGGNCCY 1 cut(s) 90
EcoT22I ATGCAT 1 cut(s) 107
FaeI CATG 1 cut(s) 266
FaiI YATR 8 cut(s) 36, 72, 85, 103, 107, 153, 264, 276
FatI CATG 1 cut(s) 262
FauI CCCGC 1 cut(s) 52
Fnu4HI GCNGC 1 cut(s) 200
FokI GGATG 1 cut(s) 229
Fsp4HI GCNGC 1 cut(s) 200
FspBI CTAG 2 cut(s) 9, 295
GluI GCNGC 1 cut(s) 200
GsuI CTGGAG 1 cut(s) 191
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 1 cut(s) 266
HinfI GANTC 1 cut(s) 271
Hpy188I TCNGA 1 cut(s) 187
Hpy188III TCNNGA 2 cut(s) 170, 215
HpyCH4V TGCA 4 cut(s) 87, 96, 105, 135
HpyF10VI GCNNNNNNNGC 5 cut(s) 12, 93, 102, 132, 285
HpyF3I CTNAG 4 cut(s) 78, 120, 184, 213
Hsp92II CATG 1 cut(s) 266
LpnPI CCDG 5 cut(s) 29, 73, 106, 155, 200
Lsp1109I GCAGC 1 cut(s) 211
LweI GCATC 1 cut(s) 2
MaeI CTAG 2 cut(s) 9, 295
MhlI GDGCHC 2 cut(s) 8, 121
MmeI TCCRAC 2 cut(s) 173, 270
MnlI CCTC 5 cut(s) 18, 43, 148, 211, 217
Mph1103I ATGCAT 1 cut(s) 107
MseI TTAA 1 cut(s) 138
MwoI GCNNNNNNNGC 5 cut(s) 12, 93, 102, 132, 285
NlaIII CATG 1 cut(s) 266
NsiI ATGCAT 1 cut(s) 107
PfeI GAWTC 1 cut(s) 271
PkrI GCNGC 1 cut(s) 201
PshBI ATTAAT 1 cut(s) 138
PspPI GGNCC 1 cut(s) 90
PstNI CAGNNNCTG 1 cut(s) 93
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 200
Sau96I GGNCC 1 cut(s) 90
SduI GDGCHC 2 cut(s) 8, 121
SetI ASST 4 cut(s) 112, 116, 204, 281
SfaNI GCATC 1 cut(s) 2
SmlI CTYRAG 2 cut(s) 22, 206
SmoI CTYRAG 2 cut(s) 22, 206
SsiI CCGC 2 cut(s) 45, 126
SspMI CTAG 2 cut(s) 9, 295
TfiI GAWTC 1 cut(s) 271
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 128
TseI GCWGC 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 279
TspRI CASTG 1 cut(s) 128
VspI ATTAAT 1 cut(s) 138
XspI CTAG 2 cut(s) 9, 295
Zsp2I ATGCAT 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.