Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0035893.1

Orthogroup ID

OG0005108

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 312

Gene Structure 312 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0035893.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

caggttaaagaggatttacgtagagctcggataggttcaaagaggttcgagtcaactgaggaattcagtgggaatatggaactggtggaagttggccaagttgaacaagtaatgactgcagataaaatggctgaagttgccataagggtactttgtgctggaatgtcagttactatgagctcactgacagagttttctattgcttctgctgaggggtatgctgatcttgtgaatcaatgggacgatgccaagactagagcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF630 DUF632

Protein Analysis

87

Amino Acids

9.62

Weight (kDa)

4.64

Isoelectric Point (pI)

46.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005108)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G19090 AT4G30130 AT4G30130 AT4G30130 AT4G30130
fragaria_vesca	FvH4_4g07580 FvH4_4g07580 FvH4_4g07580 FvH4_4g07580 FvH4_4g07580
malus_domestica	MD00G1185400.v1.1 MD13G1245700.v1.1 MD13G1245800.v1.1
prunus_persica	Prupe.1G079100_v2.0.a1 Prupe.1G079100_v2.0.a1
pyrus_communis	pycom16g21390
rosa_chinensis	RchiOBHm_Chr4g0400181
rosa_laevigata	RLG00000009206
rosa_multiflora	Rmu_sc0000037.1_g000021 Rmu_sc0011138.1_g000003 Rmu_sc0035893.1_g000001
rosa_roxburghii	Rroxscaffold_5G00345130
rosa_rugosa	Rorug04G0023200 Rorug04G0023300 Rorug04G0023400
rosa_samantha	Rh4AG098700 Rh4BG097000 Rh4CG108200 Rh4DG093700
rosa_wichuraiana	Rw4G008200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	94
AcsI	RAATTY	1 cut(s)	62
AcuI	CTGAAG	1 cut(s)	153
AfaI	GTAC	1 cut(s)	150
AgsI	TTSAA	2 cut(s)	39, 104
AluBI	AGCT	3 cut(s)	26, 180, 260
AluI	AGCT	3 cut(s)	26, 180, 260
Alw21I	GWGCWC	2 cut(s)	28, 182
AoxI	GGCC	1 cut(s)	94
ApoI	RAATTY	1 cut(s)	62
BalI	TGGCCA	1 cut(s)	96
BanII	GRGCYC	2 cut(s)	28, 182
Bbv12I	GWGCWC	2 cut(s)	28, 182
BbvCI	CCTCAGC	1 cut(s)	210
BfaI	CTAG	1 cut(s)	255
BfmI	CTRYAG	1 cut(s)	117
BmsI	GCATC	1 cut(s)	235
Bpu10I	CCTNAGC	1 cut(s)	210
BsaAI	YACGTR	1 cut(s)	20
Bse1I	ACTGG	1 cut(s)	87
BseMII	CTCAG	2 cut(s)	48, 201
BseNI	ACTGG	1 cut(s)	87
BshFI	GGCC	1 cut(s)	96
BsiHKAI	GWGCWC	2 cut(s)	28, 182
BslFI	GGGAC	1 cut(s)	254
BsmFI	GGGAC	1 cut(s)	254
BsnI	GGCC	1 cut(s)	96
Bsp1286I	GDGCHC	2 cut(s)	28, 182
Bsp143I	GATC	1 cut(s)	223
BspANI	GGCC	1 cut(s)	96
BspCNI	CTCAG	2 cut(s)	49, 202
BspMAI	CTGCAG	1 cut(s)	121
BsrI	ACTGG	1 cut(s)	87
BssMI	GATC	1 cut(s)	223
BstBAI	YACGTR	1 cut(s)	20
BstDEI	CTNAG	2 cut(s)	57, 210
BstKTI	GATC	1 cut(s)	226
BstMBI	GATC	1 cut(s)	223
BstMWI	GCNNNNNNNGC	1 cut(s)	137
BstSFI	CTRYAG	1 cut(s)	117
BstSNI	TACGTA	1 cut(s)	20
BsuRI	GGCC	1 cut(s)	96
BtsIMutI	CAGTG	2 cut(s)	73, 182
Csp6I	GTAC	1 cut(s)	149
CviJI	RGCY	5 cut(s)	26, 96, 131, 180, 260
CviKI_1	RGCY	5 cut(s)	26, 96, 131, 180, 260
CviQI	GTAC	1 cut(s)	149
DdeI	CTNAG	2 cut(s)	57, 210
DpnI	GATC	1 cut(s)	225
DpnII	GATC	1 cut(s)	223
EaeI	YGGCCR	1 cut(s)	94
Ecl136II	GAGCTC	2 cut(s)	26, 180
Eco105I	TACGTA	1 cut(s)	20
Eco24I	GRGCYC	2 cut(s)	28, 182
Eco53kI	GAGCTC	2 cut(s)	26, 180
Eco57I	CTGAAG	1 cut(s)	153
EcoICRI	GAGCTC	2 cut(s)	26, 180
EcoRI	GAATTC	1 cut(s)	62
EcoT38I	GRGCYC	2 cut(s)	28, 182
FaiI	YATR	4 cut(s)	77, 143, 176, 219
FaqI	GGGAC	1 cut(s)	254
FriOI	GRGCYC	2 cut(s)	28, 182
FspBI	CTAG	1 cut(s)	255
HaeIII	GGCC	1 cut(s)	96
HincII	GTYRAC	1 cut(s)	54
HindII	GTYRAC	1 cut(s)	54
HinfI	GANTC	2 cut(s)	50, 232
Hpy166II	GTNNAC	1 cut(s)	54
Hpy188I	TCNGA	1 cut(s)	30
Hpy8I	GTNNAC	1 cut(s)	54
HpyCH4IV	ACGT	1 cut(s)	19
HpyCH4V	TGCA	1 cut(s)	119
HpyF10VI	GCNNNNNNNGC	1 cut(s)	137
HpyF3I	CTNAG	2 cut(s)	57, 210
HpySE526I	ACGT	1 cut(s)	19
Kzo9I	GATC	1 cut(s)	223
LpnPI	CCDG	2 cut(s)	68, 144
LweI	GCATC	1 cut(s)	235
MaeI	CTAG	1 cut(s)	255
MaeII	ACGT	1 cut(s)	19
MaeIII	GTNAC	1 cut(s)	169
MalI	GATC	1 cut(s)	225
MboI	GATC	1 cut(s)	223
MhlI	GDGCHC	2 cut(s)	28, 182
MlsI	TGGCCA	1 cut(s)	96
MluCI	AATT	1 cut(s)	62
MluNI	TGGCCA	1 cut(s)	96
MlyI	GAGTC	1 cut(s)	59
MnlI	CCTC	4 cut(s)	4, 36, 52, 205
Mox20I	TGGCCA	1 cut(s)	96
MscI	TGGCCA	1 cut(s)	96
MseI	TTAA	1 cut(s)	6
Msp20I	TGGCCA	1 cut(s)	96
MwoI	GCNNNNNNNGC	1 cut(s)	137
NdeII	GATC	1 cut(s)	223
PfeI	GAWTC	1 cut(s)	232
PleI	GAGTC	1 cut(s)	58
PpsI	GAGTC	1 cut(s)	58
Ppu21I	YACGTR	1 cut(s)	20
Psp124BI	GAGCTC	2 cut(s)	28, 182
PstI	CTGCAG	1 cut(s)	121
RsaI	GTAC	1 cut(s)	150
RsaNI	GTAC	1 cut(s)	149
SacI	GAGCTC	2 cut(s)	28, 182
SaqAI	TTAA	1 cut(s)	6
Sau3AI	GATC	1 cut(s)	223
SchI	GAGTC	1 cut(s)	59
SduI	GDGCHC	2 cut(s)	28, 182
SetI	ASST	7 cut(s)	6, 22, 28, 37, 47, 182, 262
SfaNI	GCATC	1 cut(s)	235
SfcI	CTRYAG	1 cut(s)	117
SgeI	CNNG	8 cut(s)	14, 39, 61, 95, 110, 119, 171, 239
SnaBI	TACGTA	1 cut(s)	20
Sse9I	AATT	1 cut(s)	62
SspMI	CTAG	1 cut(s)	255
SstI	GAGCTC	2 cut(s)	28, 182
TaiI	ACGT	1 cut(s)	22
TaqI	TCGA	1 cut(s)	48
TasI	AATT	1 cut(s)	62
TfiI	GAWTC	1 cut(s)	232
Tru1I	TTAA	1 cut(s)	6
Tru9I	TTAA	1 cut(s)	6
TscAI	CASTG	2 cut(s)	73, 189
TspRI	CASTG	2 cut(s)	73, 189
XapI	RAATTY	1 cut(s)	62
XspI	CTAG	1 cut(s)	255

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.