Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0037109.1

Orthogroup ID

OG0008533

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 2037

Gene Structure 2037 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0037109.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 661 bp

gggttatggtggttttggtgcactgggacattctatctataccagagaattgtttccaagattggttgaaggttcatggagtgggagaatacaacatgtttcaactagtgggacgcatactgctgccatcacagaatcaggagaactttatacttggggtcgagatgaaggggatggtagattgggccttggtcctaatcgcggcccaaatgagggtggtggacttagcattccctccaaagtgaaagcattacctatgcctgtggctgctgtttcttgcggagggtttttcactatggtactaactgagaatggggaactttggaattggggggcaaactctaactttgagcttggaaggggtgatagggttggtggctggcaaccaaaacctgtacctagtcttgtaggcgttcgtatcattcaggtagcaagcggtggatatcattctgttgcattaactgatgaaggtaaagtactttcttggggccatggtggacatggtcagttgggcaactcttctgtccaaaatcaaaaaacacctacagttgtgaaggctctaactgatgagcgtgtcatatatatagcttgtggaggttcatcttcagcggctataactggtaagatgatgcctgtcttctttgggactgtgatttattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RCC1

Protein Analysis

219

Amino Acids

22.95

Weight (kDa)

7.99

Isoelectric Point (pI)

23.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008533)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G60870 AT5G60870 AT5G60870 AT5G60870
fragaria_vesca	FvH4_6g39230 FvH4_6g39230
malus_domestica	MD09G1144200.v1.1
prunus_persica	Prupe.3G183700_v2.0.a1 Prupe.3G183700_v2.0.a1
pyrus_communis	pycom09g06360 pycom17g12330
rosa_chinensis	RchiOBHm_Chr2g0153071
rosa_laevigata	RLG00000020674
rosa_multiflora	Rmu_sc0000218.1_g000027 Rmu_sc0037109.1_g000001
rosa_roxburghii	Rroxscaffold_2G00095220 Rroxscaffold_2G00095250
rosa_rugosa	Rorug02G0437100
rosa_samantha	Rh2AG499300 Rh2BG510600 Rh2CG485700 Rh2DG522300
rosa_wichuraiana	Rw2G040980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	202
AciI	CCGC	4 cut(s)	202, 280, 436, 609
AcuI	CTGAAG	1 cut(s)	589
AfaI	GTAC	3 cut(s)	301, 397, 478
AfiI	CCNNNNNNNGG	3 cut(s)	201, 212, 213
AflIII	ACRYGT	1 cut(s)	95
AgsI	TTSAA	2 cut(s)	69, 103
AhlI	ACTAGT	1 cut(s)	105
AluBI	AGCT	2 cut(s)	353, 588
AluI	AGCT	2 cut(s)	353, 588
Alw21I	GWGCWC	1 cut(s)	23
Alw44I	GTGCAC	1 cut(s)	19
AoxI	GGCC	3 cut(s)	185, 203, 488
ApaLI	GTGCAC	1 cut(s)	19
ApeKI	GCWGC	2 cut(s)	123, 267
Asp700I	GAANNNNTTC	1 cut(s)	52
AspS9I	GGNCC	4 cut(s)	185, 192, 204, 488
AsuHPI	GGTGA	1 cut(s)	375
AvaII	GGWCC	1 cut(s)	192
BaeGI	GKGCMC	1 cut(s)	23
BarI	GAAGNNNNNNTAC	2 cut(s)	460, 492
BbsI	GAAGAC	1 cut(s)	629
Bbv12I	GWGCWC	1 cut(s)	23
BbvI	GCAGC	2 cut(s)	110, 254
BccI	CCATC	2 cut(s)	135, 168
BcuI	ACTAGT	1 cut(s)	105
BfaI	CTAG	2 cut(s)	106, 400
BfmI	CTRYAG	1 cut(s)	544
BisI	GCNGC	4 cut(s)	124, 203, 268, 610
BlsI	GCNGC	4 cut(s)	125, 204, 269, 611
BmcAI	AGTACT	1 cut(s)	478
Bme18I	GGWCC	1 cut(s)	192
BmgT120I	GGNCC	4 cut(s)	185, 192, 204, 488
BmiI	GGNNCC	1 cut(s)	489
BmrI	ACTGGG	1 cut(s)	33
BmsI	GCATC	1 cut(s)	619
BmuI	ACTGGG	1 cut(s)	33
BpiI	GAAGAC	1 cut(s)	629
BsaJI	CCNNGG	2 cut(s)	188, 491
Bsc4I	CCNNNNNNNGG	3 cut(s)	201, 212, 213
Bse1I	ACTGG	2 cut(s)	28, 623
BseDI	CCNNGG	2 cut(s)	188, 491
BseGI	GGATG	1 cut(s)	179
BseLI	CCNNNNNNNGG	3 cut(s)	201, 212, 213
BseMII	CTCAG	1 cut(s)	298
BseNI	ACTGG	2 cut(s)	28, 623
BseSI	GKGCMC	1 cut(s)	23
BseXI	GCAGC	2 cut(s)	110, 254
Bsh1236I	CGCG	1 cut(s)	202
BshFI	GGCC	3 cut(s)	187, 205, 490
BsiHKAI	GWGCWC	1 cut(s)	23
BslFI	GGGAC	2 cut(s)	40, 125
BslI	CCNNNNNNNGG	3 cut(s)	201, 212, 213
BsmFI	GGGAC	2 cut(s)	40, 125
BsmI	GAATGC	1 cut(s)	229
BsnI	GGCC	3 cut(s)	187, 205, 490
Bsp1286I	GDGCHC	1 cut(s)	23
Bsp19I	CCATGG	1 cut(s)	491
BspACI	CCGC	4 cut(s)	202, 280, 436, 609
BspANI	GGCC	3 cut(s)	187, 205, 490
BspCNI	CTCAG	1 cut(s)	299
BspFNI	CGCG	1 cut(s)	202
BspLI	GGNNCC	1 cut(s)	489
BsrI	ACTGG	2 cut(s)	28, 623
BssECI	CCNNGG	2 cut(s)	188, 491
BssT1I	CCWWGG	2 cut(s)	188, 491
Bst4CI	ACNGT	2 cut(s)	548, 650
Bst6I	CTCTTC	1 cut(s)	524
BstC8I	GCNNGC	2 cut(s)	381, 434
BstDEI	CTNAG	2 cut(s)	225, 307
BstDSI	CCRYGG	1 cut(s)	491
BstF5I	GGATG	1 cut(s)	179
BstFNI	CGCG	1 cut(s)	202
BstNSI	RCATGY	1 cut(s)	99
BstSFI	CTRYAG	1 cut(s)	544
BstSLI	GKGCMC	1 cut(s)	23
BstUI	CGCG	1 cut(s)	202
BstV1I	GCAGC	2 cut(s)	110, 254
BstV2I	GAAGAC	1 cut(s)	629
BsuRI	GGCC	3 cut(s)	187, 205, 490
BtgI	CCRYGG	1 cut(s)	491
BtsCI	GGATG	1 cut(s)	179
BtsIMutI	CAGTG	1 cut(s)	21
Cac8I	GCNNGC	2 cut(s)	381, 434
Cfr13I	GGNCC	4 cut(s)	185, 192, 204, 488
CseI	GACGC	1 cut(s)	122
Csp6I	GTAC	3 cut(s)	300, 396, 477
CviAII	CATG	4 cut(s)	76, 96, 492, 501
CviJI	RGCY	9 cut(s)	187, 205, 267, 353, 379, 490, 558, 588, 612
CviKI_1	RGCY	9 cut(s)	187, 205, 267, 353, 379, 490, 558, 588, 612
CviQI	GTAC	3 cut(s)	300, 396, 477
DdeI	CTNAG	2 cut(s)	225, 307
Eam1104I	CTCTTC	1 cut(s)	524
EarI	CTCTTC	1 cut(s)	524
Eco130I	CCWWGG	2 cut(s)	188, 491
Eco32I	GATATC	1 cut(s)	444
Eco47I	GGWCC	1 cut(s)	192
Eco57I	CTGAAG	1 cut(s)	589
EcoRV	GATATC	1 cut(s)	444
EcoT14I	CCWWGG	2 cut(s)	188, 491
ErhI	CCWWGG	2 cut(s)	188, 491
FaeI	CATG	4 cut(s)	79, 99, 495, 504
FaqI	GGGAC	2 cut(s)	40, 125
FatI	CATG	4 cut(s)	75, 95, 491, 500
Fnu4HI	GCNGC	4 cut(s)	124, 203, 268, 610
FokI	GGATG	1 cut(s)	186
Fsp4HI	GCNGC	4 cut(s)	124, 203, 268, 610
FspBI	CTAG	2 cut(s)	106, 400
GluI	GCNGC	4 cut(s)	124, 203, 268, 610
HaeIII	GGCC	3 cut(s)	187, 205, 490
HgaI	GACGC	1 cut(s)	122
Hin1II	CATG	4 cut(s)	79, 99, 495, 504
HinfI	GANTC	1 cut(s)	135
HphI	GGTGA	1 cut(s)	375
Hpy166II	GTNNAC	3 cut(s)	21, 222, 498
Hpy188III	TCNNGA	2 cut(s)	139, 162
Hpy8I	GTNNAC	3 cut(s)	21, 222, 498
HpyAV	CCTTC	5 cut(s)	63, 162, 352, 462, 548
HpyCH4III	ACNGT	2 cut(s)	548, 650
HpyCH4V	TGCA	2 cut(s)	21, 456
HpyF3I	CTNAG	2 cut(s)	225, 307
Hsp92II	CATG	4 cut(s)	79, 99, 495, 504
LpnPI	CCDG	9 cut(s)	9, 56, 124, 274, 365, 406, 411, 604, 646
Lsp1109I	GCAGC	2 cut(s)	110, 254
LweI	GCATC	1 cut(s)	619
MaeI	CTAG	2 cut(s)	106, 400
MboII	GAAGA	3 cut(s)	511, 595, 629
MhlI	GDGCHC	1 cut(s)	23
MluCI	AATT	2 cut(s)	48, 326
MnlI	CCTC	4 cut(s)	206, 245, 276, 588
MroXI	GAANNNNTTC	1 cut(s)	52
MseI	TTAA	1 cut(s)	459
MspA1I	CMGCKG	1 cut(s)	609
Mva1269I	GAATGC	1 cut(s)	229
MvnI	CGCG	1 cut(s)	202
NcoI	CCATGG	1 cut(s)	491
NlaIII	CATG	4 cut(s)	79, 99, 495, 504
NlaIV	GGNNCC	1 cut(s)	489
NspI	RCATGY	1 cut(s)	99
PciI	ACATGT	1 cut(s)	95
PctI	GAATGC	1 cut(s)	229
PdmI	GAANNNNTTC	1 cut(s)	52
PfeI	GAWTC	1 cut(s)	135
PflFI	GACNNNGTC	1 cut(s)	502
PkrI	GCNGC	4 cut(s)	125, 204, 269, 611
PscI	ACATGT	1 cut(s)	95
PspN4I	GGNNCC	1 cut(s)	489
PspPI	GGNCC	4 cut(s)	185, 192, 204, 488
PsyI	GACNNNGTC	1 cut(s)	502
RsaI	GTAC	3 cut(s)	301, 397, 478
RsaNI	GTAC	3 cut(s)	300, 396, 477
SaqAI	TTAA	1 cut(s)	459
SatI	GCNGC	4 cut(s)	124, 203, 268, 610
Sau96I	GGNCC	4 cut(s)	185, 192, 204, 488
ScaI	AGTACT	1 cut(s)	478
SduI	GDGCHC	1 cut(s)	23
SfaNI	GCATC	1 cut(s)	619
SfcI	CTRYAG	1 cut(s)	544
SinI	GGWCC	1 cut(s)	192
SpeI	ACTAGT	1 cut(s)	105
Sse9I	AATT	2 cut(s)	48, 326
SsiI	CCGC	4 cut(s)	202, 280, 436, 609
SspMI	CTAG	2 cut(s)	106, 400
StyI	CCWWGG	2 cut(s)	188, 491
TaaI	ACNGT	2 cut(s)	548, 650
TaqI	TCGA	1 cut(s)	161
TasI	AATT	2 cut(s)	48, 326
TatI	WGTACW	1 cut(s)	476
TauI	GCSGC	2 cut(s)	205, 612
TfiI	GAWTC	1 cut(s)	135
Tru1I	TTAA	1 cut(s)	459
Tru9I	TTAA	1 cut(s)	459
TscAI	CASTG	1 cut(s)	28
TseI	GCWGC	2 cut(s)	123, 267
TspDTI	ATGAA	4 cut(s)	64, 181, 481, 589
TspRI	CASTG	1 cut(s)	28
Tth111I	GACNNNGTC	1 cut(s)	502
VneI	GTGCAC	1 cut(s)	19
VpaK11BI	GGWCC	1 cut(s)	192
XceI	RCATGY	1 cut(s)	99
XcmI	CCANNNNNNNNNTGG	1 cut(s)	498
XmnI	GAANNNNTTC	1 cut(s)	52
XspI	CTAG	2 cut(s)	106, 400
ZrmI	AGTACT	1 cut(s)	478

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.