Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040810.1

Orthogroup ID

OG0010085

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1460

Gene Structure 1460 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040810.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 598 bp

caggcatcaaagagcacccattaaacaaatgggttggcttacagtaaacaatgcatctacaacctcattgacttgggggaactctatcttcacttgtgggaagtgtattggcctctatgatgcgcaaaagtgtttgccagccaaatcatgcagtggagttgcatttagtccaagagcttttgcaagccggaattcgctgaagaagttgagaagggagagactagcaagcgaaagggtagcagataaaactactgctagttctgaaaatgttcaaaatgacaacaaggtggagctttctgatgattcagctgcagagaaaggggttaatatcccttccagaggtgctgtgcttcaggcttgcactgttacttccgggttgatagctgctttgggtatactaattcgacaggcatctcatgttgcatcggttgaaggattaccagtccttgactgctcattggaagtatcatgtacgccttcacaaactcttctctgtgcaaaaatgtcaaatcattcaaactctattttcgttcgtctttatgaggagccctgcatctctggcagagagacagccaatgagaaagctattctgaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Abi

Protein Analysis

198

Amino Acids

21.26

Weight (kDa)

9.03

Isoelectric Point (pI)

50.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010085)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G26085 AT3G26085 AT3G26085 AT3G26085
fragaria_vesca	FvH4_4g24960 FvH4_4g24960
malus_domestica	MD13G1107700.v1.1 MD16G1107600.v1.1
prunus_persica	Prupe.1G238700_v2.0.a1 Prupe.1G238700_v2.0.a1 Prupe.1G238700_v2.0.a1 Prupe.1G238700_v2.0.a1 Prupe.1G238700_v2.0.a1
pyrus_communis	pycom16g09180
rosa_chinensis	RchiOBHm_Chr4g0432001
rosa_multiflora	Rmu_sc0040810.1_g000001
rosa_roxburghii	Rroxscaffold_5G00373550
rosa_samantha	Rh4BG318600 Rh4CG333900 Rh4DG313500
rosa_wichuraiana	Rw4G027080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	124
AccI	GTMKAC	1 cut(s)	395
AcsI	RAATTY	1 cut(s)	191
AcuI	CTGAAG	2 cut(s)	219, 336
AfaI	GTAC	1 cut(s)	473
AfiI	CCNNNNNNNGG	1 cut(s)	339
AgsI	TTSAA	3 cut(s)	273, 432, 517
AluBI	AGCT	5 cut(s)	177, 293, 309, 384, 585
AluI	AGCT	5 cut(s)	177, 293, 309, 384, 585
Alw21I	GWGCWC	1 cut(s)	17
Alw26I	GTCTC	2 cut(s)	212, 561
AoxI	GGCC	1 cut(s)	110
ApeKI	GCWGC	2 cut(s)	309, 384
ApoI	RAATTY	1 cut(s)	191
Asp700I	GAANNNNTTC	1 cut(s)	268
AspLEI	GCGC	1 cut(s)	125
AsuC2I	CCSGG	1 cut(s)	374
BanII	GRGCYC	1 cut(s)	550
Bbv12I	GWGCWC	1 cut(s)	17
BbvI	GCAGC	2 cut(s)	296, 371
BcnI	CCSGG	1 cut(s)	374
BcoDI	GTCTC	2 cut(s)	212, 561
BfaI	CTAG	2 cut(s)	222, 256
BfmI	CTRYAG	1 cut(s)	310
BisI	GCNGC	2 cut(s)	310, 385
BlsI	GCNGC	2 cut(s)	311, 386
Bme1390I	CCNGG	1 cut(s)	374
BmiI	GGNNCC	1 cut(s)	547
BmrFI	CCNGG	1 cut(s)	374
BmsI	GCATC	6 cut(s)	14, 63, 110, 420, 432, 562
BpuMI	CCSGG	1 cut(s)	374
Bsc4I	CCNNNNNNNGG	1 cut(s)	339
Bse1I	ACTGG	1 cut(s)	441
BseLI	CCNNNNNNNGG	1 cut(s)	339
BseNI	ACTGG	1 cut(s)	441
BseRI	GAGGAG	1 cut(s)	558
BseXI	GCAGC	2 cut(s)	296, 371
BshFI	GGCC	1 cut(s)	112
BsiHKAI	GWGCWC	1 cut(s)	17
BsiSI	CCGG	2 cut(s)	188, 373
BslI	CCNNNNNNNGG	1 cut(s)	339
BsmAI	GTCTC	2 cut(s)	212, 561
BsnI	GGCC	1 cut(s)	112
Bsp1286I	GDGCHC	2 cut(s)	17, 550
BspANI	GGCC	1 cut(s)	112
BspLI	GGNNCC	1 cut(s)	547
BspMAI	CTGCAG	1 cut(s)	314
BsrI	ACTGG	1 cut(s)	441
BssNAI	GTATAC	1 cut(s)	396
Bst1107I	GTATAC	1 cut(s)	396
Bst4CI	ACNGT	2 cut(s)	44, 365
Bst6I	CTCTTC	1 cut(s)	493
BstC8I	GCNNGC	4 cut(s)	139, 185, 227, 359
BstENI	CCTNNNNNAGG	1 cut(s)	337
BstHHI	GCGC	1 cut(s)	125
BstMAI	GTCTC	2 cut(s)	212, 561
BstMWI	GCNNNNNNNGC	1 cut(s)	559
BstSCI	CCNGG	1 cut(s)	372
BstSFI	CTRYAG	1 cut(s)	310
BstV1I	GCAGC	2 cut(s)	296, 371
BstZ17I	GTATAC	1 cut(s)	396
BsuRI	GGCC	1 cut(s)	112
BtsI	GCAGTG	1 cut(s)	158
BtsIMutI	CAGTG	2 cut(s)	158, 361
Cac8I	GCNNGC	4 cut(s)	139, 185, 227, 359
CfoI	GCGC	1 cut(s)	125
Csp6I	GTAC	1 cut(s)	472
CviAII	CATG	3 cut(s)	148, 417, 469
CviQI	GTAC	1 cut(s)	472
Eam1104I	CTCTTC	1 cut(s)	493
EarI	CTCTTC	1 cut(s)	493
Eco24I	GRGCYC	1 cut(s)	550
Eco57I	CTGAAG	2 cut(s)	219, 336
EcoNI	CCTNNNNNAGG	1 cut(s)	337
EcoRI	GAATTC	1 cut(s)	191
EcoT22I	ATGCAT	1 cut(s)	56
EcoT38I	GRGCYC	1 cut(s)	550
FaeI	CATG	3 cut(s)	151, 420, 472
FaiI	YATR	6 cut(s)	118, 149, 396, 418, 470, 541
FatI	CATG	3 cut(s)	147, 416, 468
FblI	GTMKAC	1 cut(s)	395
Fnu4HI	GCNGC	2 cut(s)	310, 385
FriOI	GRGCYC	1 cut(s)	550
Fsp4HI	GCNGC	2 cut(s)	310, 385
FspBI	CTAG	2 cut(s)	222, 256
FspI	TGCGCA	1 cut(s)	124
GlaI	GCGC	1 cut(s)	124
GluI	GCNGC	2 cut(s)	310, 385
HaeIII	GGCC	1 cut(s)	112
HapII	CCGG	2 cut(s)	188, 373
HhaI	GCGC	1 cut(s)	125
Hin1II	CATG	3 cut(s)	151, 420, 472
Hin6I	GCGC	1 cut(s)	123
HinP1I	GCGC	1 cut(s)	123
HinfI	GANTC	1 cut(s)	303
HpaII	CCGG	2 cut(s)	188, 373
Hpy166II	GTNNAC	2 cut(s)	47, 396
Hpy188I	TCNGA	3 cut(s)	263, 299, 592
Hpy188III	TCNNGA	1 cut(s)	337
Hpy8I	GTNNAC	2 cut(s)	47, 396
HpyAV	CCTTC	4 cut(s)	205, 343, 426, 487
HpyCH4III	ACNGT	2 cut(s)	44, 365
HpyCH4V	TGCA	9 cut(s)	54, 151, 162, 183, 312, 361, 423, 498, 553
HpyF10VI	GCNNNNNNNGC	1 cut(s)	559
Hsp92II	CATG	3 cut(s)	151, 420, 472
HspAI	GCGC	1 cut(s)	123
LmnI	GCTCC	2 cut(s)	290, 545
LpnPI	CCDG	9 cut(s)	151, 201, 339, 350, 386, 393, 454, 544, 563
Lsp1109I	GCAGC	2 cut(s)	296, 371
LweI	GCATC	6 cut(s)	14, 63, 110, 420, 432, 562
MaeI	CTAG	2 cut(s)	222, 256
MaeIII	GTNAC	1 cut(s)	365
MboII	GAAGA	3 cut(s)	80, 212, 480
MhlI	GDGCHC	2 cut(s)	17, 550
MluCI	AATT	2 cut(s)	191, 400
MnlI	CCTC	4 cut(s)	74, 123, 333, 536
Mph1103I	ATGCAT	1 cut(s)	56
MroXI	GAANNNNTTC	1 cut(s)	268
MseI	TTAA	2 cut(s)	22, 325
MspA1I	CMGCKG	1 cut(s)	309
MspI	CCGG	2 cut(s)	188, 373
MspR9I	CCNGG	1 cut(s)	374
MwoI	GCNNNNNNNGC	1 cut(s)	559
NciI	CCSGG	1 cut(s)	374
NlaIII	CATG	3 cut(s)	151, 420, 472
NlaIV	GGNNCC	1 cut(s)	547
NsbI	TGCGCA	1 cut(s)	124
NsiI	ATGCAT	1 cut(s)	56
PdmI	GAANNNNTTC	1 cut(s)	268
PfeI	GAWTC	1 cut(s)	303
PkrI	GCNGC	2 cut(s)	311, 386
PspN4I	GGNNCC	1 cut(s)	547
PstI	CTGCAG	1 cut(s)	314
PvuII	CAGCTG	1 cut(s)	309
RsaI	GTAC	1 cut(s)	473
RsaNI	GTAC	1 cut(s)	472
SaqAI	TTAA	2 cut(s)	22, 325
SatI	GCNGC	2 cut(s)	310, 385
ScrFI	CCNGG	1 cut(s)	374
SduI	GDGCHC	2 cut(s)	17, 550
SetI	ASST	8 cut(s)	66, 179, 289, 295, 311, 344, 386, 587
SfaNI	GCATC	6 cut(s)	14, 63, 110, 420, 432, 562
SfcI	CTRYAG	1 cut(s)	310
Sse9I	AATT	2 cut(s)	191, 400
SspMI	CTAG	2 cut(s)	222, 256
StyD4I	CCNGG	1 cut(s)	372
TaaI	ACNGT	2 cut(s)	44, 365
TaqI	TCGA	1 cut(s)	404
TasI	AATT	2 cut(s)	191, 400
TfiI	GAWTC	1 cut(s)	303
Tru1I	TTAA	2 cut(s)	22, 325
Tru9I	TTAA	2 cut(s)	22, 325
TscAI	CASTG	2 cut(s)	158, 368
TseI	GCWGC	2 cut(s)	309, 384
TspRI	CASTG	2 cut(s)	158, 368
XagI	CCTNNNNNAGG	1 cut(s)	337
XapI	RAATTY	1 cut(s)	191
XcmI	CCANNNNNNNNNTGG	1 cut(s)	26
XmiI	GTMKAC	1 cut(s)	395
XmnI	GAANNNNTTC	1 cut(s)	268
XspI	CTAG	2 cut(s)	222, 256
Zsp2I	ATGCAT	1 cut(s)	56

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.