Rmu_sc0041866.1_g000004

Adipocyte plasma membrane-associated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041866.1
Physical Location & Seq
Forward (+)
17338 .. 17808
471 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041866.1_g000004.1.cds

Sequence Viewer

Length: 381 bp
atggctctgaaacatttgctaacctcatgttcagcctttgttttagcttgtttgcttgcattcacagttcaagtctacttgttctcaccaatatccccagtctcacttgaactgcctccaccatcttcttctccacttcctcaaaacaacatattacagagagtgattaagcttggagatggagtacttctgaaaccagaagatattgctttggataaagaaggcacactctacacggccactagagatggttggatcaaaaggcttcacagaaatgggtcctgggaggattggaagatgttgaatagtcatacacttcttggaattactatcacaaacgaaggtgatctcgttgcatgtgatgttgatcaggtaatgtaa

Protein Analysis

126

Amino Acids

13.92

Weight (kDa)

5.47

Isoelectric Point (pI)

54.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016236)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 75
AclWI GGATC 1 cut(s) 263
AcoI YGGCCR 1 cut(s) 237
AfaI GTAC 1 cut(s) 186
AgsI TTSAA 3 cut(s) 71, 110, 304
AjnI CCWGG 1 cut(s) 281
AluBI AGCT 2 cut(s) 47, 172
AluI AGCT 2 cut(s) 47, 172
Alw26I GTCTC 1 cut(s) 106
AlwI GGATC 1 cut(s) 263
AoxI GGCC 1 cut(s) 237
AspS9I GGNCC 1 cut(s) 279
AsuHPI GGTGA 2 cut(s) 78, 356
AvaII GGWCC 1 cut(s) 279
BccI CCATC 3 cut(s) 130, 173, 242
BceAI ACGGC 1 cut(s) 252
BciT130I CCWGG 1 cut(s) 283
BclI TGATCA 1 cut(s) 367
BcoDI GTCTC 1 cut(s) 106
BfaI CTAG 1 cut(s) 243
BmcAI AGTACT 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 283
Bme18I GGWCC 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 279
BmiI GGNNCC 1 cut(s) 280
BmrFI CCNGG 1 cut(s) 283
BmrI ACTGGG 1 cut(s) 92
BmuI ACTGGG 1 cut(s) 92
BsaBI GATNNNNATC 1 cut(s) 366
BsaJI CCNNGG 1 cut(s) 282
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
Bse1I ACTGG 1 cut(s) 98
Bse8I GATNNNNATC 1 cut(s) 366
BseBI CCWGG 1 cut(s) 283
BseDI CCNNGG 1 cut(s) 282
BseJI GATNNNNATC 1 cut(s) 366
BseNI ACTGG 1 cut(s) 98
BshFI GGCC 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 106
BsmI GAATGC 1 cut(s) 59
BsnI GGCC 1 cut(s) 239
Bsp143I GATC 3 cut(s) 255, 346, 367
BspANI GGCC 1 cut(s) 239
BspLI GGNNCC 1 cut(s) 280
BspPI GGATC 1 cut(s) 263
BsrI ACTGG 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 282
BssMI GATC 3 cut(s) 255, 346, 367
Bst2UI CCWGG 1 cut(s) 283
Bst4CI ACNGT 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 57
BstKTI GATC 3 cut(s) 258, 349, 370
BstMAI GTCTC 1 cut(s) 106
BstMBI GATC 3 cut(s) 255, 346, 367
BstNI CCWGG 1 cut(s) 283
BstNSI RCATGY 1 cut(s) 360
BstSCI CCNGG 1 cut(s) 281
BsuRI GGCC 1 cut(s) 239
Cac8I GCNNGC 1 cut(s) 57
Cfr13I GGNCC 1 cut(s) 279
Csp6I GTAC 1 cut(s) 185
CviAII CATG 2 cut(s) 27, 357
CviJI RGCY 6 cut(s) 5, 35, 47, 172, 239, 265
CviKI_1 RGCY 6 cut(s) 5, 35, 47, 172, 239, 265
CviQI GTAC 1 cut(s) 185
DpnI GATC 3 cut(s) 257, 348, 369
DpnII GATC 3 cut(s) 255, 346, 367
EaeI YGGCCR 1 cut(s) 237
Eco47I GGWCC 1 cut(s) 279
EcoO109I RGGNCCY 1 cut(s) 279
EcoRII CCWGG 1 cut(s) 281
FaeI CATG 2 cut(s) 30, 360
FaiI YATR 4 cut(s) 28, 152, 312, 358
FatI CATG 2 cut(s) 26, 356
FbaI TGATCA 1 cut(s) 367
FblI GTMKAC 1 cut(s) 75
FspBI CTAG 1 cut(s) 243
HaeIII GGCC 1 cut(s) 239
Hin1II CATG 2 cut(s) 30, 360
HindIII AAGCTT 1 cut(s) 170
HphI GGTGA 2 cut(s) 78, 356
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 2 cut(s) 9, 192
Hpy8I GTNNAC 1 cut(s) 76
HpyAV CCTTC 2 cut(s) 215, 335
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4V TGCA 2 cut(s) 59, 356
Hsp92II CATG 2 cut(s) 30, 360
Ksp22I TGATCA 1 cut(s) 367
Kzo9I GATC 3 cut(s) 255, 346, 367
LpnPI CCDG 5 cut(s) 111, 210, 268, 295, 356
MaeI CTAG 1 cut(s) 243
MalI GATC 3 cut(s) 257, 348, 369
MboI GATC 3 cut(s) 255, 346, 367
MboII GAAGA 4 cut(s) 117, 120, 212, 307
MluCI AATT 1 cut(s) 324
MmeI TCCRAC 1 cut(s) 233
MnlI CCTC 4 cut(s) 34, 126, 150, 280
MseI TTAA 1 cut(s) 168
MslI CAYNNNNRTG 1 cut(s) 273
MspR9I CCNGG 1 cut(s) 283
Mva1269I GAATGC 1 cut(s) 59
MvaI CCWGG 1 cut(s) 283
NdeII GATC 3 cut(s) 255, 346, 367
NlaIII CATG 2 cut(s) 30, 360
NlaIV GGNNCC 1 cut(s) 280
NspI RCATGY 1 cut(s) 360
PctI GAATGC 1 cut(s) 59
PpuMI RGGWCCY 1 cut(s) 279
Psp5II RGGWCCY 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 281
PspGI CCWGG 1 cut(s) 281
PspN4I GGNNCC 1 cut(s) 280
PspPI GGNCC 1 cut(s) 279
PspPPI RGGWCCY 1 cut(s) 279
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
RseI CAYNNNNRTG 1 cut(s) 273
SaqAI TTAA 1 cut(s) 168
Sau3AI GATC 3 cut(s) 255, 346, 367
Sau96I GGNCC 1 cut(s) 279
ScaI AGTACT 1 cut(s) 186
ScrFI CCNGG 1 cut(s) 283
SetI ASST 5 cut(s) 26, 49, 174, 346, 375
SinI GGWCC 1 cut(s) 279
SmiMI CAYNNNNRTG 1 cut(s) 273
Sse9I AATT 1 cut(s) 324
SspMI CTAG 1 cut(s) 243
StyD4I CCNGG 1 cut(s) 281
TaaI ACNGT 1 cut(s) 67
TasI AATT 1 cut(s) 324
TatI WGTACW 1 cut(s) 184
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
VpaK11BI GGWCC 1 cut(s) 279
XceI RCATGY 1 cut(s) 360
XmiI GTMKAC 1 cut(s) 75
XspI CTAG 1 cut(s) 243
ZrmI AGTACT 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.