Rmu_sc0042680.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042680.1
OG0013711
Physical Location & Seq
Forward (+)
1559 .. 2608
1050 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042680.1_g000002.1.cds

Sequence Viewer

Length: 609 bp
atgggaggaggaaccatgcatattgattttcctatcatccacatcaaaccctcttcttctaatactactgataataaaattatcagtaataatcttaattttccagtttcaaacagttatgttggagctgttaaaccctcttgttctgcttcacagtgctactgtgggaatgaaacttgcaggaagaaattagagcttgtttatggaaaagaagagaaaagagcaagtgggcctttgattagcagctctgtttttgggtctgttccttcccaatttgaagttcaaagtgcaattgctgcacttctgaattttatgcttggggtaaattcatctgagtcagacttgcagtggcttcagaaattgttggattcttgtgttacaagaaagttactgtcctatggacacagaaaagtttatgatgctttccagttgctgcaagcagatccttctgttcaggtgccttcttgtttaagcttgagcgacaaatctaattctgcagtttcaagattggtgctttccctatcctctgataaagccctatgggatgctattaccaacaacgacttggtcaagaagctccaagagccacctggttcaggtgtgtattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

202

Amino Acids

21.87

Weight (kDa)

8.18

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 457
AclWI GGATC 1 cut(s) 437
AcsI RAATTY 2 cut(s) 307, 325
AcuI CTGAAG 1 cut(s) 338
AfiI CCNNNNNNNGG 1 cut(s) 596
AgsI TTSAA 4 cut(s) 111, 278, 284, 504
AjnI CCWGG 1 cut(s) 589
AjuI GAANNNNNNNTTGG 2 cut(s) 264, 296
AluBI AGCT 5 cut(s) 128, 196, 246, 474, 577
AluI AGCT 5 cut(s) 128, 196, 246, 474, 577
AlwI GGATC 1 cut(s) 437
AlwNI CAGNNNCTG 1 cut(s) 433
AoxI GGCC 1 cut(s) 230
ApeKI GCWGC 3 cut(s) 243, 296, 433
ApoI RAATTY 2 cut(s) 307, 325
AspS9I GGNCC 1 cut(s) 230
BanI GGYRCC 1 cut(s) 457
BbvI GCAGC 3 cut(s) 255, 283, 420
BciT130I CCWGG 1 cut(s) 591
BfmI CTRYAG 1 cut(s) 495
BisI GCNGC 3 cut(s) 244, 297, 434
BlsI GCNGC 3 cut(s) 245, 298, 435
Bme1390I CCNGG 1 cut(s) 591
BmgT120I GGNCC 1 cut(s) 230
BmiI GGNNCC 2 cut(s) 13, 459
BmrFI CCNGG 1 cut(s) 591
BmsI GCATC 2 cut(s) 409, 535
BpuEI CTTGAG 1 cut(s) 496
Bsc4I CCNNNNNNNGG 1 cut(s) 596
Bse1I ACTGG 2 cut(s) 104, 427
BseBI CCWGG 1 cut(s) 591
BseGI GGATG 2 cut(s) 36, 550
BseLI CCNNNNNNNGG 1 cut(s) 596
BseMII CTCAG 1 cut(s) 324
BseNI ACTGG 2 cut(s) 104, 427
BseRI GAGGAG 1 cut(s) 21
BseXI GCAGC 3 cut(s) 255, 283, 420
BsgI GTGCAG 1 cut(s) 282
BshFI GGCC 1 cut(s) 232
BshNI GGYRCC 1 cut(s) 457
BslI CCNNNNNNNGG 1 cut(s) 596
BsnI GGCC 1 cut(s) 232
Bsp143I GATC 1 cut(s) 442
BspANI GGCC 1 cut(s) 232
BspCNI CTCAG 1 cut(s) 325
BspLI GGNNCC 2 cut(s) 13, 459
BspMAI CTGCAG 1 cut(s) 499
BspPI GGATC 1 cut(s) 437
BspT107I GGYRCC 1 cut(s) 457
BsrI ACTGG 2 cut(s) 104, 427
BssMI GATC 1 cut(s) 442
Bst2UI CCWGG 1 cut(s) 591
Bst4CI ACNGT 4 cut(s) 116, 156, 164, 393
Bst6I CTCTTC 2 cut(s) 58, 207
BstAPI GCANNNNNTGC 1 cut(s) 296
BstC8I GCNNGC 1 cut(s) 438
BstDEI CTNAG 1 cut(s) 333
BstENI CCTNNNNNAGG 1 cut(s) 594
BstF5I GGATG 2 cut(s) 36, 550
BstKTI GATC 1 cut(s) 445
BstMBI GATC 1 cut(s) 442
BstMWI GCNNNNNNNGC 2 cut(s) 296, 583
BstNI CCWGG 1 cut(s) 591
BstSCI CCNGG 1 cut(s) 589
BstSFI CTRYAG 1 cut(s) 495
BstV1I GCAGC 3 cut(s) 255, 283, 420
BstX2I RGATCY 1 cut(s) 442
BstYI RGATCY 1 cut(s) 442
BsuRI GGCC 1 cut(s) 232
BtsCI GGATG 2 cut(s) 36, 550
BtsI GCAGTG 1 cut(s) 353
BtsIMutI CAGTG 2 cut(s) 161, 353
Cac8I GCNNGC 1 cut(s) 438
CaiI CAGNNNCTG 1 cut(s) 433
Cfr13I GGNCC 1 cut(s) 230
CsiI ACCWGGT 1 cut(s) 589
CviAII CATG 1 cut(s) 16
CviJI RGCY 9 cut(s) 128, 196, 232, 246, 352, 474, 536, 577, 586
CviKI_1 RGCY 9 cut(s) 128, 196, 232, 246, 352, 474, 536, 577, 586
DdeI CTNAG 1 cut(s) 333
DpnI GATC 1 cut(s) 444
DpnII GATC 1 cut(s) 442
Eam1104I CTCTTC 2 cut(s) 58, 207
EarI CTCTTC 2 cut(s) 58, 207
Eco57I CTGAAG 1 cut(s) 338
EcoNI CCTNNNNNAGG 1 cut(s) 594
EcoRII CCWGG 1 cut(s) 589
EcoT22I ATGCAT 1 cut(s) 21
FaeI CATG 1 cut(s) 19
FaiI YATR 8 cut(s) 17, 21, 120, 204, 314, 399, 417, 541
FalI AAGNNNNNCTT 2 cut(s) 217, 249
FatI CATG 1 cut(s) 15
Fnu4HI GCNGC 3 cut(s) 244, 297, 434
FokI GGATG 2 cut(s) 23, 557
Fsp4HI GCNGC 3 cut(s) 244, 297, 434
GluI GCNGC 3 cut(s) 244, 297, 434
HaeIII GGCC 1 cut(s) 232
Hin1II CATG 1 cut(s) 19
HindIII AAGCTT 1 cut(s) 472
HinfI GANTC 2 cut(s) 335, 368
Hpy188I TCNGA 5 cut(s) 306, 334, 340, 357, 529
Hpy188III TCNNGA 2 cut(s) 504, 571
HpyAV CCTTC 3 cut(s) 276, 456, 471
HpyCH4III ACNGT 4 cut(s) 116, 156, 164, 393
HpyCH4V TGCA 7 cut(s) 19, 180, 290, 299, 346, 436, 497
HpyF10VI GCNNNNNNNGC 2 cut(s) 296, 583
HpyF3I CTNAG 1 cut(s) 333
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 1 cut(s) 442
LmnI GCTCC 2 cut(s) 125, 582
LpnPI CCDG 7 cut(s) 117, 166, 440, 440, 576, 582, 603
Lsp1109I GCAGC 3 cut(s) 255, 283, 420
LweI GCATC 2 cut(s) 409, 535
MabI ACCWGGT 1 cut(s) 589
MaeIII GTNAC 2 cut(s) 376, 387
MalI GATC 1 cut(s) 444
MboI GATC 1 cut(s) 442
MboII GAAGA 4 cut(s) 45, 48, 196, 224
MfeI CAATTG 1 cut(s) 291
MflI RGATCY 1 cut(s) 442
MluCI AATT 9 cut(s) 78, 97, 188, 272, 291, 307, 325, 359, 490
MlyI GAGTC 1 cut(s) 344
MmeI TCCRAC 2 cut(s) 103, 345
MnlI CCTC 3 cut(s) 61, 148, 535
Mph1103I ATGCAT 1 cut(s) 21
MseI TTAA 4 cut(s) 96, 132, 470, 607
MspR9I CCNGG 1 cut(s) 591
MunI CAATTG 1 cut(s) 291
MvaI CCWGG 1 cut(s) 591
MwoI GCNNNNNNNGC 2 cut(s) 296, 583
NdeII GATC 1 cut(s) 442
NlaIII CATG 1 cut(s) 19
NlaIV GGNNCC 2 cut(s) 13, 459
NsiI ATGCAT 1 cut(s) 21
PfeI GAWTC 1 cut(s) 368
PflFI GACNNNGTC 1 cut(s) 566
PkrI GCNGC 3 cut(s) 245, 298, 435
PleI GAGTC 1 cut(s) 343
PpsI GAGTC 1 cut(s) 343
Psp6I CCWGG 1 cut(s) 589
PspGI CCWGG 1 cut(s) 589
PspN4I GGNNCC 2 cut(s) 13, 459
PspPI GGNCC 1 cut(s) 230
PstI CTGCAG 1 cut(s) 499
PstNI CAGNNNCTG 1 cut(s) 433
PsuI RGATCY 1 cut(s) 442
PsyI GACNNNGTC 1 cut(s) 566
SaqAI TTAA 4 cut(s) 96, 132, 470, 607
SatI GCNGC 3 cut(s) 244, 297, 434
Sau3AI GATC 1 cut(s) 442
Sau96I GGNCC 1 cut(s) 230
SchI GAGTC 1 cut(s) 344
ScrFI CCNGG 1 cut(s) 591
SetI ASST 8 cut(s) 130, 198, 248, 459, 476, 579, 592, 601
SexAI ACCWGGT 1 cut(s) 589
SfaNI GCATC 2 cut(s) 409, 535
SfcI CTRYAG 1 cut(s) 495
SmlI CTYRAG 1 cut(s) 475
SmoI CTYRAG 1 cut(s) 475
Sse9I AATT 9 cut(s) 78, 97, 188, 272, 291, 307, 325, 359, 490
StyD4I CCNGG 1 cut(s) 589
TaaI ACNGT 4 cut(s) 116, 156, 164, 393
TasI AATT 9 cut(s) 78, 97, 188, 272, 291, 307, 325, 359, 490
TfiI GAWTC 1 cut(s) 368
Tru1I TTAA 4 cut(s) 96, 132, 470, 607
Tru9I TTAA 4 cut(s) 96, 132, 470, 607
TscAI CASTG 2 cut(s) 161, 353
TseI GCWGC 3 cut(s) 243, 296, 433
TspDTI ATGAA 2 cut(s) 186, 318
TspRI CASTG 2 cut(s) 161, 353
Tth111I GACNNNGTC 1 cut(s) 566
XagI CCTNNNNNAGG 1 cut(s) 594
XapI RAATTY 2 cut(s) 307, 325
XcmI CCANNNNNNNNNTGG 2 cut(s) 562, 587
Zsp2I ATGCAT 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.