Rmu_sc0042878.1_g000001

domain in TBC and LysM domain containing proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042878.1
OG0013334
Physical Location & Seq
Forward (+)
1 .. 1906
1906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042878.1_g000001.1.cds

Sequence Viewer

Length: 939 bp
aagtttcttacttgggttttgaagacagtgtctagtctccctggttgctttaccgagtttgtgtatgcagtactcaaacattctgcttctcaagaggctggactggaatgttcgacttcttcagctgcagttacttcgtcaactgtggcatgcagtgctaatcttttgacccctggaatagcctgggctatgtccctcacactaacaggccctctaagtgaagagatctcaagggcatgcttcccttcagatgctaatggaataaataatgacctactttacaggtcacatcttcatgggagagggttgaatagattctggtctaatgttcaaggttaccaaggtccactgcttgttctgatttctgcaacctcagaagatggtagtgccaataaaagaaattggattgtaggtgttctcacacatcaaggttttgagaatagggatctcttctatggaagtccaggaagtctgtacgctataagtccagtctttcatgtgtatccacctactggaaaggaaatgaactttgtgtatagccacctccatcccactggcaaggtgtatgaggtgaaaccgaagcctgttggaataggatttggtggaactctgggaaatgagagaatttatgtggatgaagatttttctaaggttaccatacgccatcatgcagctgacaaaacttatcagtctggctccctttttcctgatcagggctttctacctgttgaagctttgatcacagaagttgaaatttggggacttggtggaaggggcgcaaaggatgtgcaggattcatataagaatagggaacaacttttcactgagcaaagacgaaaggttgacttgaaaacatttgcaaactgggaggattcacctgaaaagatgatgatggacatggtctccaaccccaatgcagttcgacgtgaagaccggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TLD

Protein Analysis

312

Amino Acids

34.52

Weight (kDa)

6.33

Isoelectric Point (pI)

39.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013334)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G39590
fragaria_vesca FvH4_2g38790 FvH4_2g38790
malus_domestica MD09G1232000.v1.1
prunus_persica Prupe.1G368700_v2.0.a1
pyrus_communis pycom09g15130
rosa_chinensis RchiOBHm_Chr6g0302501
rosa_laevigata RLG00000011167
rosa_multiflora Rmu_sc0011021.1_g000010 Rmu_sc0018485.1_g000004 Rmu_sc0042878.1_g000001
rosa_roxburghii Rroxscaffold_7G00165710
rosa_rugosa Rorug06G0314600
rosa_samantha Rh6AG427800 Rh6BG474900 Rh6CG439900 Rh6DG426900
rosa_wichuraiana Rw6G037000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 512
AclWI GGATC 1 cut(s) 453
AcsI RAATTY 2 cut(s) 624, 753
AcuI CTGAAG 2 cut(s) 105, 231
AfaI GTAC 2 cut(s) 72, 476
AfiI CCNNNNNNNGG 2 cut(s) 512, 713
AgeI ACCGGT 1 cut(s) 933
AgsI TTSAA 6 cut(s) 22, 310, 332, 731, 752, 850
AjiI CACGTC 1 cut(s) 926
AjnI CCWGG 4 cut(s) 40, 172, 182, 463
AluBI AGCT 3 cut(s) 125, 674, 734
AluI AGCT 3 cut(s) 125, 674, 734
Alw26I GTCTC 2 cut(s) 41, 907
AlwI GGATC 1 cut(s) 453
AoxI GGCC 1 cut(s) 208
ApeKI GCWGC 2 cut(s) 125, 671
ApoI RAATTY 2 cut(s) 624, 753
AsiGI ACCGGT 1 cut(s) 933
Asp700I GAANNNNTTC 1 cut(s) 314
AspLEI GCGC 1 cut(s) 779
AspS9I GGNCC 2 cut(s) 209, 344
AsuHPI GGTGA 2 cut(s) 583, 867
AvaII GGWCC 1 cut(s) 344
BbsI GAAGAC 1 cut(s) 29
BbvI GCAGC 2 cut(s) 112, 683
BccI CCATC 4 cut(s) 374, 555, 672, 886
BcgI CGANNNNNNTGC 2 cut(s) 117, 151
BciT130I CCWGG 4 cut(s) 42, 174, 184, 465
BciVI GTATCC 1 cut(s) 513
BclI TGATCA 2 cut(s) 709, 738
BcoDI GTCTC 2 cut(s) 41, 907
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 126
BfuI GTATCC 1 cut(s) 513
BglII AGATCT 1 cut(s) 225
BisI GCNGC 2 cut(s) 126, 672
BlsI GCNGC 2 cut(s) 127, 673
BmcAI AGTACT 1 cut(s) 72
Bme1390I CCNGG 4 cut(s) 42, 174, 184, 465
Bme18I GGWCC 1 cut(s) 344
BmgBI CACGTC 1 cut(s) 926
BmgT120I GGNCC 2 cut(s) 209, 344
BmiI GGNNCC 1 cut(s) 697
BmrFI CCNGG 4 cut(s) 42, 174, 184, 465
BmrI ACTGGG 1 cut(s) 874
BmsI GCATC 1 cut(s) 241
BmuI ACTGGG 1 cut(s) 874
BpiI GAAGAC 1 cut(s) 29
BpuEI CTTGAG 2 cut(s) 75, 214
BsaI GGTCTC 1 cut(s) 907
BsaJI CCNNGG 4 cut(s) 40, 172, 183, 340
BsaWI WCCGGW 1 cut(s) 933
BsaXI ACNNNNNCTCC 2 cut(s) 887, 917
Bsc4I CCNNNNNNNGG 2 cut(s) 512, 713
Bse118I RCCGGY 1 cut(s) 933
Bse1I ACTGG 5 cut(s) 108, 488, 517, 559, 869
BseBI CCWGG 4 cut(s) 42, 174, 184, 465
BseDI CCNNGG 4 cut(s) 40, 172, 183, 340
BseGI GGATG 3 cut(s) 547, 640, 790
BseLI CCNNNNNNNGG 2 cut(s) 512, 713
BseMII CTCAG 2 cut(s) 387, 816
BseNI ACTGG 5 cut(s) 108, 488, 517, 559, 869
BseXI GCAGC 2 cut(s) 112, 683
BsgI GTGCAG 1 cut(s) 809
BshFI GGCC 1 cut(s) 210
BshTI ACCGGT 1 cut(s) 933
BsiSI CCGG 1 cut(s) 934
BslFI GGGAC 2 cut(s) 178, 774
BslI CCNNNNNNNGG 2 cut(s) 512, 713
BsmAI GTCTC 2 cut(s) 41, 907
BsmFI GGGAC 2 cut(s) 178, 774
BsnI GGCC 1 cut(s) 210
Bso31I GGTCTC 1 cut(s) 907
Bsp143I GATC 4 cut(s) 225, 445, 709, 738
BspANI GGCC 1 cut(s) 210
BspCNI CTCAG 2 cut(s) 386, 817
BspLI GGNNCC 1 cut(s) 697
BspMAI CTGCAG 1 cut(s) 130
BspPI GGATC 1 cut(s) 453
BspTNI GGTCTC 1 cut(s) 907
BsrFI RCCGGY 1 cut(s) 933
BsrI ACTGG 5 cut(s) 108, 488, 517, 559, 869
BssAI RCCGGY 1 cut(s) 933
BssECI CCNNGG 4 cut(s) 40, 172, 183, 340
BssMI GATC 4 cut(s) 225, 445, 709, 738
BssT1I CCWWGG 1 cut(s) 340
Bst2UI CCWGG 4 cut(s) 42, 174, 184, 465
Bst4CI ACNGT 2 cut(s) 28, 145
Bst6I CTCTTC 2 cut(s) 216, 455
BstAPI GCANNNNNTGC 1 cut(s) 155
BstC8I GCNNGC 2 cut(s) 151, 238
BstDEI CTNAG 4 cut(s) 215, 373, 648, 825
BstEII GGTNACC 2 cut(s) 335, 652
BstF5I GGATG 3 cut(s) 547, 640, 790
BstHHI GCGC 1 cut(s) 779
BstKTI GATC 4 cut(s) 228, 448, 712, 741
BstMAI GTCTC 2 cut(s) 41, 907
BstMBI GATC 4 cut(s) 225, 445, 709, 738
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNI CCWGG 4 cut(s) 42, 174, 184, 465
BstNSI RCATGY 2 cut(s) 153, 240
BstPI GGTNACC 2 cut(s) 335, 652
BstSCI CCNGG 4 cut(s) 40, 172, 182, 463
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 2 cut(s) 112, 683
BstV2I GAAGAC 1 cut(s) 29
BstX2I RGATCY 2 cut(s) 225, 445
BstXI CCANNNNNNTGG 1 cut(s) 554
BstYI RGATCY 2 cut(s) 225, 445
BsuI GTATCC 1 cut(s) 513
BsuRI GGCC 1 cut(s) 210
BtrI CACGTC 1 cut(s) 926
BtsCI GGATG 3 cut(s) 547, 640, 790
BtsI GCAGTG 2 cut(s) 160, 347
BtsIMutI CAGTG 5 cut(s) 33, 160, 347, 552, 822
Cac8I GCNNGC 2 cut(s) 151, 238
CfoI GCGC 1 cut(s) 779
Cfr10I RCCGGY 1 cut(s) 933
Cfr13I GGNCC 2 cut(s) 209, 344
Csp6I GTAC 2 cut(s) 71, 475
CspAI ACCGGT 1 cut(s) 933
CviAII CATG 6 cut(s) 150, 237, 296, 497, 668, 898
CviQI GTAC 2 cut(s) 71, 475
DdeI CTNAG 4 cut(s) 215, 373, 648, 825
DpnI GATC 4 cut(s) 227, 447, 711, 740
DpnII GATC 4 cut(s) 225, 445, 709, 738
Eam1104I CTCTTC 2 cut(s) 216, 455
EarI CTCTTC 2 cut(s) 216, 455
Eco130I CCWWGG 1 cut(s) 340
Eco31I GGTCTC 1 cut(s) 907
Eco47I GGWCC 1 cut(s) 344
Eco57I CTGAAG 2 cut(s) 105, 231
Eco91I GGTNACC 2 cut(s) 335, 652
EcoO109I RGGNCCY 1 cut(s) 209
EcoO65I GGTNACC 2 cut(s) 335, 652
EcoRII CCWGG 4 cut(s) 40, 172, 182, 463
EcoT14I CCWWGG 1 cut(s) 340
ErhI CCWWGG 1 cut(s) 340
FaeI CATG 6 cut(s) 153, 240, 299, 500, 671, 901
FalI AAGNNNNNCTT 2 cut(s) 830, 862
FaqI GGGAC 2 cut(s) 178, 774
FatI CATG 6 cut(s) 149, 236, 295, 496, 667, 897
FbaI TGATCA 2 cut(s) 709, 738
Fnu4HI GCNGC 2 cut(s) 126, 672
FokI GGATG 3 cut(s) 534, 647, 797
Fsp4HI GCNGC 2 cut(s) 126, 672
FspBI CTAG 1 cut(s) 33
GlaI GCGC 1 cut(s) 778
GluI GCNGC 2 cut(s) 126, 672
HaeIII GGCC 1 cut(s) 210
HapII CCGG 1 cut(s) 934
HhaI GCGC 1 cut(s) 779
Hin1II CATG 6 cut(s) 153, 240, 299, 500, 671, 901
Hin6I GCGC 1 cut(s) 777
HinP1I GCGC 1 cut(s) 777
HincII GTYRAC 2 cut(s) 141, 844
HindII GTYRAC 2 cut(s) 141, 844
HindIII AAGCTT 1 cut(s) 732
HinfI GANTC 3 cut(s) 315, 794, 872
HpaII CCGG 1 cut(s) 934
HphI GGTGA 2 cut(s) 583, 867
Hpy166II GTNNAC 3 cut(s) 141, 347, 844
Hpy188I TCNGA 3 cut(s) 250, 360, 376
Hpy188III TCNNGA 2 cut(s) 92, 707
Hpy8I GTNNAC 3 cut(s) 141, 347, 844
Hpy99I CGWCG 1 cut(s) 927
HpyAV CCTTC 2 cut(s) 255, 765
HpyCH4III ACNGT 2 cut(s) 28, 145
HpyCH4IV ACGT 1 cut(s) 925
HpyCH4V TGCA 8 cut(s) 68, 128, 153, 368, 671, 790, 860, 917
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 4 cut(s) 215, 373, 648, 825
HpySE526I ACGT 1 cut(s) 925
Hsp92II CATG 6 cut(s) 153, 240, 299, 500, 671, 901
HspAI GCGC 1 cut(s) 777
Ksp22I TGATCA 2 cut(s) 709, 738
Kzo9I GATC 4 cut(s) 225, 445, 709, 738
LmnI GCTCC 1 cut(s) 701
Lsp1109I GCAGC 2 cut(s) 112, 683
LweI GCATC 1 cut(s) 241
MaeI CTAG 1 cut(s) 33
MaeII ACGT 1 cut(s) 925
MaeIII GTNAC 4 cut(s) 130, 285, 335, 652
MalI GATC 4 cut(s) 227, 447, 711, 740
MboI GATC 4 cut(s) 225, 445, 709, 738
MboII GAAGA 7 cut(s) 34, 111, 233, 284, 389, 442, 650
MflI RGATCY 2 cut(s) 225, 445
MluCI AATT 3 cut(s) 400, 624, 753
MmeI TCCRAC 2 cut(s) 568, 930
MnlI CCTC 8 cut(s) 88, 206, 222, 296, 382, 554, 562, 862
MroXI GAANNNNTTC 1 cut(s) 314
MslI CAYNNNNRTG 1 cut(s) 294
MspA1I CMGCKG 2 cut(s) 125, 674
MspI CCGG 1 cut(s) 934
MspR9I CCNGG 4 cut(s) 42, 174, 184, 465
MvaI CCWGG 4 cut(s) 42, 174, 184, 465
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 4 cut(s) 225, 445, 709, 738
NlaIII CATG 6 cut(s) 153, 240, 299, 500, 671, 901
NlaIV GGNNCC 1 cut(s) 697
NmuCI GTSAC 1 cut(s) 285
NspI RCATGY 2 cut(s) 153, 240
PaeI GCATGC 2 cut(s) 153, 240
PdmI GAANNNNTTC 1 cut(s) 314
PfeI GAWTC 3 cut(s) 315, 794, 872
PflFI GACNNNGTC 2 cut(s) 28, 899
PflMI CCANNNNNTGG 1 cut(s) 512
PfoI TCCNGGA 1 cut(s) 463
PinAI ACCGGT 1 cut(s) 933
PkrI GCNGC 2 cut(s) 127, 673
Psp6I CCWGG 4 cut(s) 40, 172, 182, 463
PspEI GGTNACC 2 cut(s) 335, 652
PspGI CCWGG 4 cut(s) 40, 172, 182, 463
PspN4I GGNNCC 1 cut(s) 697
PspPI GGNCC 2 cut(s) 209, 344
PstI CTGCAG 1 cut(s) 130
PsuI RGATCY 2 cut(s) 225, 445
PsyI GACNNNGTC 2 cut(s) 28, 899
PvuII CAGCTG 2 cut(s) 125, 674
RsaI GTAC 2 cut(s) 72, 476
RsaNI GTAC 2 cut(s) 71, 475
RseI CAYNNNNRTG 1 cut(s) 294
SatI GCNGC 2 cut(s) 126, 672
Sau3AI GATC 4 cut(s) 225, 445, 709, 738
Sau96I GGNCC 2 cut(s) 209, 344
ScaI AGTACT 1 cut(s) 72
ScrFI CCNGG 4 cut(s) 42, 174, 184, 465
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 126
SinI GGWCC 1 cut(s) 344
SmiMI CAYNNNNRTG 1 cut(s) 294
SmlI CTYRAG 2 cut(s) 90, 229
SmoI CTYRAG 2 cut(s) 90, 229
SphI GCATGC 2 cut(s) 153, 240
Sse9I AATT 3 cut(s) 400, 624, 753
SspMI CTAG 1 cut(s) 33
StyD4I CCNGG 4 cut(s) 40, 172, 182, 463
StyI CCWWGG 1 cut(s) 340
TaaI ACNGT 2 cut(s) 28, 145
TaiI ACGT 1 cut(s) 928
TaqI TCGA 2 cut(s) 113, 922
TasI AATT 3 cut(s) 400, 624, 753
TatI WGTACW 1 cut(s) 70
TfiI GAWTC 3 cut(s) 315, 794, 872
TscAI CASTG 5 cut(s) 33, 160, 354, 559, 829
TseFI GTSAC 1 cut(s) 285
TseI GCWGC 2 cut(s) 125, 671
Tsp45I GTSAC 1 cut(s) 285
TspDTI ATGAA 5 cut(s) 284, 485, 539, 651, 786
TspRI CASTG 5 cut(s) 33, 160, 354, 559, 829
Tth111I GACNNNGTC 2 cut(s) 28, 899
Van91I CCANNNNNTGG 1 cut(s) 512
VpaK11BI GGWCC 1 cut(s) 344
XapI RAATTY 2 cut(s) 624, 753
XceI RCATGY 2 cut(s) 153, 240
XmnI GAANNNNTTC 1 cut(s) 314
XspI CTAG 1 cut(s) 33
ZrmI AGTACT 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.