Rmu_ssc0000158.1_g000015

Nucleobase-ascorbate transporter 3-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000158.1
Physical Location & Seq
Reverse (-)
78543 .. 82308
3766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000158.1_g000015.1.cds

Sequence Viewer

Length: 1668 bp
atggagaagatggtggaaacagggcacagccacaaccacaaccacaaccacaatccgccacctccgacggctccaccgcctgctcgtctaccgcttggagcggcaaggggcccgttatggactccaacagagcaactccaccagcttcagtattgcatccattccaatccctcttggccggagacattcttactggcttttcagcactatattgtcatgcttggatctatagttttgattgccagtacacttgtgcctcggatgggtggggatcatggtgataaagcccgcgttattcagacgttgcttttcatgtcagcaataaacaccttgcttcaaacgttttttggatcaaggcttccaacagtgatgaatccctcatttgcttatatgctgccagtgtcgtcgatcattaatgattactctaataggacttttaaaagtgaacatgagagatttgaggtcacaatgagaacgattcaaggatcccttattgtatcttcgttcgtcaacatcttcattggctatagtagagcatggggaagctgtacaaggcgctttagtcccattgttatcgtgccagtggtttgtgtggttggtcttggtcttttcgcgaggggcttcccacttctggctaattgtgtggagcttggcctgcctatgctgatactgctggtcattacccaacagtatctgaggcgcattattcctagagcacatgccatgcttgagaggtatgctttgcttctctgcgttgggattgtctggtcatttgctgctatcctcaccgaggctggtacttataacaatgttggagagcagactaaacaaagttgccgtacagatcactcttaccttataacctctgctccttggattagaatctcatatccatttcagtggggtgcacccatattcagagcaagccatgtctttgggatgatgggagcagcaattgtcacaactgcagagacaactggaacattgtttgcagcagcacggctttcaggtgctaccccccctccagcacatgtcttgagcagcagcattggcctacagggtattggcatgctgcttgaaggaatatttggtgctgctgttggtaccactgcatcagtagaaaatgtgggcctgcttggattgacacacatagggagcaggagagtagtgcagatatcaactgctttcatgttcttcttctctatatttgggaagtttggtgctttctttgcatctattcccttaccaatcttcgctgctatatactgtgttttatttgggattgttgctgctgttgggatcactttcatgcagtttgtgaataataattccttaagaaacatgtacgttgtggggctttccctgtttcttgggatatcaatacctcaatattttatcacgaccacaactgcagatggtgtcggaccagttagaacagatggtatatggtttgacgattggttgaacacaatcttctcttcgagcccgactgtggcaatcgttgtcgggacgctgcttgacaacacactcgatgccaagtctgcagtcgatgacagagggcttggatggtggaagcccttccagcacaggaatggagatgttagaaatgaagaattttatagccttcctcttagaatacgcgagtatctccccagtagatttctctga

Protein Analysis

555

Amino Acids

61.1

Weight (kDa)

9.06

Isoelectric Point (pI)

36.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014167)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G26510
fragaria_vesca FvH4_2g40710 FvH4_2g40710 FvH4_2g40710
malus_domestica MD08G1041700.v1.1 MD15G1035100.v1.1
prunus_persica Prupe.1G389400_v2.0.a1
pyrus_communis pycom08g03370 pycom15g03230
rosa_chinensis RchiOBHm_Chr6g0299891
rosa_laevigata RLG00000011378
rosa_multiflora Rmu_ssc0000158.1_g000015
rosa_roxburghii Rroxscaffold_7G00168300
rosa_rugosa Rorug06G0293000
rosa_samantha Rh6AG404400 Rh6CG418700
rosa_wichuraiana Rw6G035370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 804, 860
Acc65I GGTACC 1 cut(s) 1103
AccB1I GGYRCC 1 cut(s) 1103
AccBSI CCGCTC 1 cut(s) 101
AccI GTMKAC 1 cut(s) 88
AccII CGCG 3 cut(s) 291, 614, 1641
AciI CCGC 5 cut(s) 56, 77, 92, 101, 289
AclI AACGTT 1 cut(s) 341
AclWI GGATC 6 cut(s) 232, 279, 358, 480, 493, 1307
AcoI YGGCCR 1 cut(s) 176
AcsI RAATTY 1 cut(s) 1613
AcuI CTGAAG 1 cut(s) 131
AfaI GTAC 6 cut(s) 247, 550, 799, 841, 1105, 1346
AfiI CCNNNNNNNGG 4 cut(s) 263, 631, 790, 1492
AflII CTTAAG 1 cut(s) 1333
AflIII ACRYGT 2 cut(s) 1030, 1341
AgsI TTSAA 4 cut(s) 338, 482, 1079, 1465
AjuI GAANNNNNNNTTGG 2 cut(s) 1071, 1103
AluBI AGCT 3 cut(s) 145, 546, 649
AluI AGCT 3 cut(s) 145, 546, 649
Alw21I GWGCWC 2 cut(s) 718, 910
Alw26I GTCTC 2 cut(s) 176, 965
Alw44I GTGCAC 1 cut(s) 906
AlwI GGATC 6 cut(s) 232, 279, 358, 480, 493, 1307
AlwNI CAGNNNCTG 1 cut(s) 694
AoxI GGCC 5 cut(s) 109, 176, 652, 1051, 1129
ApaI GGGCCC 1 cut(s) 113
ApaLI GTGCAC 1 cut(s) 906
ApoI RAATTY 1 cut(s) 1613
AseI ATTAAT 1 cut(s) 414
Asp700I GAANNNNTTC 1 cut(s) 1577
Asp718I GGTACC 1 cut(s) 1103
AspLEI GCGC 2 cut(s) 558, 702
AspS9I GGNCC 4 cut(s) 109, 110, 1129, 1424
AsuHPI GGTGA 2 cut(s) 290, 778
AvaII GGWCC 1 cut(s) 1424
BaeGI GKGCMC 3 cut(s) 27, 113, 910
BaeI ACNNNNGTAYC 2 cut(s) 1628, 1661
BamHI GGATCC 1 cut(s) 485
BanI GGYRCC 1 cut(s) 1103
BanII GRGCYC 2 cut(s) 113, 1487
Bbv12I GWGCWC 2 cut(s) 718, 910
BccI CCATC 6 cut(s) 4, 256, 937, 1409, 1433, 1560
BceAI ACGGC 3 cut(s) 84, 822, 1016
BcoDI GTCTC 2 cut(s) 176, 965
BfaI CTAG 1 cut(s) 711
BfmI CTRYAG 6 cut(s) 228, 526, 966, 1055, 1410, 1542
BfoI RGCGCY 1 cut(s) 559
BfrI CTTAAG 1 cut(s) 1333
Bme18I GGWCC 1 cut(s) 1424
BmgT120I GGNCC 4 cut(s) 109, 110, 1129, 1424
BmiI GGNNCC 5 cut(s) 72, 110, 111, 487, 1105
BmrI ACTGGG 1 cut(s) 1647
BmsI GCATC 4 cut(s) 165, 1121, 1241, 1522
BmuI ACTGGG 1 cut(s) 1647
BpmI CTGGAG 1 cut(s) 1008
BpuEI CTTGAG 2 cut(s) 749, 1057
BsaBI GATNNNNATC 1 cut(s) 881
BsaJI CCNNGG 3 cut(s) 257, 789, 872
BsaXI ACNNNNNCTCC 4 cut(s) 853, 883, 1006, 1036
Bsc4I CCNNNNNNNGG 4 cut(s) 263, 631, 790, 1492
Bse1I ACTGG 7 cut(s) 198, 243, 398, 581, 982, 1427, 1653
Bse8I GATNNNNATC 1 cut(s) 881
BseDI CCNNGG 3 cut(s) 257, 789, 872
BseGI GGATG 4 cut(s) 156, 267, 945, 1571
BseJI GATNNNNATC 1 cut(s) 881
BseLI CCNNNNNNNGG 4 cut(s) 263, 631, 790, 1492
BseMII CTCAG 1 cut(s) 686
BseNI ACTGG 7 cut(s) 198, 243, 398, 581, 982, 1427, 1653
BseSI GKGCMC 3 cut(s) 27, 113, 910
BsgI GTGCAG 1 cut(s) 1190
Bsh1236I CGCG 3 cut(s) 291, 614, 1641
BshFI GGCC 5 cut(s) 111, 178, 654, 1053, 1131
BshNI GGYRCC 1 cut(s) 1103
BsiHKAI GWGCWC 2 cut(s) 718, 910
BsiSI CCGG 1 cut(s) 179
BslFI GGGAC 2 cut(s) 549, 1522
BslI CCNNNNNNNGG 4 cut(s) 263, 631, 790, 1492
BsmAI GTCTC 2 cut(s) 176, 965
BsmFI GGGAC 2 cut(s) 549, 1522
BsnI GGCC 5 cut(s) 111, 178, 654, 1053, 1131
Bsp120I GGGCCC 1 cut(s) 109
Bsp1286I GDGCHC 5 cut(s) 27, 113, 718, 910, 1487
Bsp1407I TGTACA 1 cut(s) 548
Bsp143I GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
Bsp68I TCGCGA 1 cut(s) 614
BspACI CCGC 5 cut(s) 56, 77, 92, 101, 289
BspANI GGCC 5 cut(s) 111, 178, 654, 1053, 1131
BspCNI CTCAG 1 cut(s) 687
BspFNI CGCG 3 cut(s) 291, 614, 1641
BspLI GGNNCC 5 cut(s) 72, 110, 111, 487, 1105
BspMAI CTGCAG 3 cut(s) 970, 1414, 1546
BspPI GGATC 6 cut(s) 232, 279, 358, 480, 493, 1307
BspT107I GGYRCC 1 cut(s) 1103
BspTI CTTAAG 1 cut(s) 1333
BsrBI CCGCTC 1 cut(s) 101
BsrGI TGTACA 1 cut(s) 548
BsrI ACTGG 7 cut(s) 198, 243, 398, 581, 982, 1427, 1653
BssECI CCNNGG 3 cut(s) 257, 789, 872
BssMI GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
BssT1I CCWWGG 1 cut(s) 872
Bst4CI ACNGT 4 cut(s) 367, 690, 1268, 1492
Bst6I CTCTTC 1 cut(s) 1483
BstAFI CTTAAG 1 cut(s) 1333
BstAUI TGTACA 1 cut(s) 548
BstC8I GCNNGC 6 cut(s) 81, 289, 656, 925, 1070, 1133
BstDEI CTNAG 2 cut(s) 695, 1631
BstENI CCTNNNNNAGG 1 cut(s) 788
BstF5I GGATG 4 cut(s) 156, 267, 945, 1571
BstFNI CGCG 3 cut(s) 291, 614, 1641
BstH2I RGCGCY 1 cut(s) 559
BstHHI GCGC 2 cut(s) 558, 702
BstKTI GATC 7 cut(s) 227, 274, 353, 411, 488, 847, 1302
BstMAI GTCTC 2 cut(s) 176, 965
BstMBI GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
BstMWI GCNNNNNNNGC 6 cut(s) 655, 670, 1050, 1229, 1541, 1582
BstNSI RCATGY 4 cut(s) 722, 1034, 1072, 1345
BstSFI CTRYAG 6 cut(s) 228, 526, 966, 1055, 1410, 1542
BstSLI GKGCMC 3 cut(s) 27, 113, 910
BstUI CGCG 3 cut(s) 291, 614, 1641
BstX2I RGATCY 2 cut(s) 224, 485
BstXI CCANNNNNNTGG 2 cut(s) 900, 935
BstYI RGATCY 2 cut(s) 224, 485
BsuRI GGCC 5 cut(s) 111, 178, 654, 1053, 1131
BtsCI GGATG 4 cut(s) 156, 267, 945, 1571
BtsI GCAGTG 1 cut(s) 1107
BtsIMutI CAGTG 5 cut(s) 372, 405, 588, 905, 1107
BtuMI TCGCGA 1 cut(s) 614
Cac8I GCNNGC 6 cut(s) 81, 289, 656, 925, 1070, 1133
CaiI CAGNNNCTG 1 cut(s) 694
CfoI GCGC 2 cut(s) 558, 702
Cfr13I GGNCC 4 cut(s) 109, 110, 1129, 1424
CseI GACGC 1 cut(s) 1519
Csp6I GTAC 6 cut(s) 246, 549, 798, 840, 1104, 1345
CviQI GTAC 6 cut(s) 246, 549, 798, 840, 1104, 1345
DdeI CTNAG 2 cut(s) 695, 1631
DpnI GATC 7 cut(s) 226, 273, 352, 410, 487, 846, 1301
DpnII GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
DraI TTTAAA 1 cut(s) 439
EaeI YGGCCR 1 cut(s) 176
Eam1104I CTCTTC 1 cut(s) 1483
EarI CTCTTC 1 cut(s) 1483
EciI GGCGGA 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 872
Eco24I GRGCYC 2 cut(s) 113, 1487
Eco32I GATATC 2 cut(s) 1176, 1377
Eco47I GGWCC 1 cut(s) 1424
Eco57I CTGAAG 1 cut(s) 131
EcoNI CCTNNNNNAGG 1 cut(s) 788
EcoO109I RGGNCCY 1 cut(s) 109
EcoRV GATATC 2 cut(s) 1176, 1377
EcoT14I CCWWGG 1 cut(s) 872
EcoT38I GRGCYC 2 cut(s) 113, 1487
ErhI CCWWGG 1 cut(s) 872
FalI AAGNNNNNCTT 2 cut(s) 474, 506
FaqI GGGAC 2 cut(s) 549, 1522
FauI CCCGC 1 cut(s) 296
FblI GTMKAC 1 cut(s) 88
FokI GGATG 4 cut(s) 143, 274, 952, 1578
FriOI GRGCYC 2 cut(s) 113, 1487
FspBI CTAG 1 cut(s) 711
GlaI GCGC 2 cut(s) 557, 701
GsuI CTGGAG 1 cut(s) 1008
HaeII RGCGCY 1 cut(s) 559
HaeIII GGCC 5 cut(s) 111, 178, 654, 1053, 1131
HapII CCGG 1 cut(s) 179
HgaI GACGC 1 cut(s) 1519
HhaI GCGC 2 cut(s) 558, 702
Hin6I GCGC 2 cut(s) 556, 700
HinP1I GCGC 2 cut(s) 556, 700
HincII GTYRAC 1 cut(s) 511
HindII GTYRAC 1 cut(s) 511
HinfI GANTC 4 cut(s) 121, 373, 478, 882
HpaII CCGG 1 cut(s) 179
HphI GGTGA 2 cut(s) 290, 778
Hpy166II GTNNAC 5 cut(s) 89, 248, 446, 511, 908
Hpy188I TCNGA 7 cut(s) 66, 261, 300, 696, 920, 1424, 1667
Hpy188III TCNNGA 4 cut(s) 613, 1036, 1399, 1507
Hpy8I GTNNAC 5 cut(s) 89, 248, 446, 511, 908
Hpy99I CGWCG 2 cut(s) 70, 409
HpyAV CCTTC 3 cut(s) 1073, 1588, 1634
HpyCH4III ACNGT 4 cut(s) 367, 690, 1268, 1492
HpyCH4IV ACGT 3 cut(s) 302, 341, 1347
HpyF10VI GCNNNNNNNGC 6 cut(s) 655, 670, 1050, 1229, 1541, 1582
HpyF3I CTNAG 2 cut(s) 695, 1631
HpySE526I ACGT 3 cut(s) 302, 341, 1347
HspAI GCGC 2 cut(s) 556, 700
KpnI GGTACC 1 cut(s) 1107
Kzo9I GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
LmnI GCTCC 6 cut(s) 76, 98, 646, 874, 947, 1155
LweI GCATC 4 cut(s) 165, 1121, 1241, 1522
MaeI CTAG 1 cut(s) 711
MaeII ACGT 3 cut(s) 302, 341, 1347
MaeIII GTNAC 2 cut(s) 463, 958
MalI GATC 7 cut(s) 226, 273, 352, 410, 487, 846, 1301
MbiI CCGCTC 1 cut(s) 101
MboI GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
MboII GAAGA 9 cut(s) 19, 492, 508, 1186, 1189, 1243, 1465, 1470, 1622
MfeI CAATTG 1 cut(s) 954
MflI RGATCY 2 cut(s) 224, 485
MhlI GDGCHC 5 cut(s) 27, 113, 718, 910, 1487
MluCI AATT 4 cut(s) 637, 954, 1327, 1613
MlyI GAGTC 1 cut(s) 115
MmeI TCCRAC 5 cut(s) 89, 149, 386, 793, 1402
MroXI GAANNNNTTC 1 cut(s) 1577
MseI TTAA 3 cut(s) 414, 438, 1334
MslI CAYNNNNRTG 3 cut(s) 898, 1307, 1590
MspCI CTTAAG 1 cut(s) 1333
MspI CCGG 1 cut(s) 179
MunI CAATTG 1 cut(s) 954
MvnI CGCG 3 cut(s) 291, 614, 1641
MwoI GCNNNNNNNGC 6 cut(s) 655, 670, 1050, 1229, 1541, 1582
NdeII GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
NlaIV GGNNCC 5 cut(s) 72, 110, 111, 487, 1105
NmuCI GTSAC 2 cut(s) 463, 958
NruI TCGCGA 1 cut(s) 614
NspI RCATGY 4 cut(s) 722, 1034, 1072, 1345
PaeI GCATGC 1 cut(s) 1072
PciI ACATGT 2 cut(s) 1030, 1341
PdmI GAANNNNTTC 1 cut(s) 1577
PfeI GAWTC 3 cut(s) 373, 478, 882
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
PscI ACATGT 2 cut(s) 1030, 1341
PshBI ATTAAT 1 cut(s) 414
PsiI TTATAA 2 cut(s) 804, 860
Psp1406I AACGTT 1 cut(s) 341
PspN4I GGNNCC 5 cut(s) 72, 110, 111, 487, 1105
PspOMI GGGCCC 1 cut(s) 109
PspPI GGNCC 4 cut(s) 109, 110, 1129, 1424
PstI CTGCAG 3 cut(s) 970, 1414, 1546
PstNI CAGNNNCTG 1 cut(s) 694
PsuI RGATCY 2 cut(s) 224, 485
RruI TCGCGA 1 cut(s) 614
RsaI GTAC 6 cut(s) 247, 550, 799, 841, 1105, 1346
RsaNI GTAC 6 cut(s) 246, 549, 798, 840, 1104, 1345
RseI CAYNNNNRTG 3 cut(s) 898, 1307, 1590
SaqAI TTAA 3 cut(s) 414, 438, 1334
Sau3AI GATC 7 cut(s) 224, 271, 350, 408, 485, 844, 1299
Sau96I GGNCC 4 cut(s) 109, 110, 1129, 1424
SchI GAGTC 1 cut(s) 115
SduI GDGCHC 5 cut(s) 27, 113, 718, 910, 1487
SfaNI GCATC 4 cut(s) 165, 1121, 1241, 1522
SfcI CTRYAG 6 cut(s) 228, 526, 966, 1055, 1410, 1542
SinI GGWCC 1 cut(s) 1424
SmiMI CAYNNNNRTG 3 cut(s) 898, 1307, 1590
SmlI CTYRAG 3 cut(s) 728, 1036, 1333
SmoI CTYRAG 3 cut(s) 728, 1036, 1333
SphI GCATGC 1 cut(s) 1072
Sse9I AATT 4 cut(s) 637, 954, 1327, 1613
SsiI CCGC 5 cut(s) 56, 77, 92, 101, 289
SspI AATATT 2 cut(s) 1086, 1391
SspMI CTAG 1 cut(s) 711
StyI CCWWGG 1 cut(s) 872
TaaI ACNGT 4 cut(s) 367, 690, 1268, 1492
TaiI ACGT 3 cut(s) 305, 344, 1350
TaqI TCGA 4 cut(s) 407, 1481, 1530, 1548
TasI AATT 4 cut(s) 637, 954, 1327, 1613
TatI WGTACW 2 cut(s) 245, 548
TauI GCSGC 1 cut(s) 104
TfiI GAWTC 3 cut(s) 373, 478, 882
Tru1I TTAA 3 cut(s) 414, 438, 1334
Tru9I TTAA 3 cut(s) 414, 438, 1334
TscAI CASTG 5 cut(s) 372, 405, 588, 905, 1114
TseFI GTSAC 2 cut(s) 463, 958
Tsp45I GTSAC 2 cut(s) 463, 958
TspDTI ATGAA 6 cut(s) 301, 386, 508, 1177, 1297, 1623
TspRI CASTG 5 cut(s) 372, 405, 588, 905, 1114
Vha464I CTTAAG 1 cut(s) 1333
VneI GTGCAC 1 cut(s) 906
VpaK11BI GGWCC 1 cut(s) 1424
VspI ATTAAT 1 cut(s) 414
XagI CCTNNNNNAGG 1 cut(s) 788
XapI RAATTY 1 cut(s) 1613
XceI RCATGY 4 cut(s) 722, 1034, 1072, 1345
XcmI CCANNNNNNNNNTGG 1 cut(s) 1589
XmiI GTMKAC 1 cut(s) 88
XmnI GAANNNNTTC 1 cut(s) 1577
XspI CTAG 1 cut(s) 711
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.