Rmu_ssc0000264.1_g000039

Pentatricopeptide repeat-containing protein At2g20710, mitochondrial-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000264.1
Physical Location & Seq
Forward (+)
224232 .. 224591
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000264.1_g000039.1.cds

Sequence Viewer

Length: 360 bp
atgtatgactttcgggtgctgaacaggcttcttattgtctattgcaaaatgggtcttttggacaaggcagaatcacttgtaaacaaggctgtggaaggaagaattccttatgccagcacatggcatgtgctagtaataggttttatggagaataagcagatacccagggcagttgagatgttgaagaatgcactttcagttggaagattcgggtggatgccgaatccagccactttcactgcctttctggattatttggaatggaaaggagatgttgaaagcaatggaagagatgataattctgtcaaacaaattggatccggtgtccaagggtttgtatcagagactgttgaggactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

13.43

Weight (kDa)

5.4

Isoelectric Point (pI)

34.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018494)

Species Orthologous Gene IDs
malus_domestica MD09G1248900.v1.1
prunus_persica Prupe.3G136700_v2.0.a1
pyrus_communis pycom09g16580
rosa_chinensis RchiOBHm_Chr2g0126311
rosa_laevigata RLG00000018900
rosa_multiflora Rmu_ssc0000264.1_g000039
rosa_roxburghii Rroxscaffold_2G00117250
rosa_samantha Rh2AG319400 Rh2BG327800 Rh2DG347500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 120
AclWI GGATC 2 cut(s) 312, 325
AcsI RAATTY 1 cut(s) 102
AfiI CCNNNNNNNGG 1 cut(s) 120
AgsI TTSAA 2 cut(s) 184, 278
AjnI CCWGG 1 cut(s) 164
Alw26I GTCTC 1 cut(s) 338
AlwI GGATC 2 cut(s) 312, 325
AlwNI CAGNNNCTG 1 cut(s) 347
ApoI RAATTY 1 cut(s) 102
BamHI GGATCC 1 cut(s) 317
BciT130I CCWGG 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 338
BfaI CTAG 2 cut(s) 131, 358
Bme1390I CCNGG 1 cut(s) 166
BmiI GGNNCC 1 cut(s) 319
BmrFI CCNGG 1 cut(s) 166
BmsI GCATC 1 cut(s) 207
BsaJI CCNNGG 3 cut(s) 164, 165, 328
BsaWI WCCGGW 1 cut(s) 320
Bsc4I CCNNNNNNNGG 1 cut(s) 120
Bse3DI GCAATG 1 cut(s) 289
BseBI CCWGG 1 cut(s) 166
BseDI CCNNGG 3 cut(s) 164, 165, 328
BseGI GGATG 1 cut(s) 222
BseLI CCNNNNNNNGG 1 cut(s) 120
BseMI GCAATG 1 cut(s) 289
BsiSI CCGG 1 cut(s) 321
BslI CCNNNNNNNGG 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 338
BsmI GAATGC 1 cut(s) 193
Bsp143I GATC 1 cut(s) 317
BspLI GGNNCC 1 cut(s) 319
BspPI GGATC 2 cut(s) 312, 325
BsrDI GCAATG 1 cut(s) 289
BssECI CCNNGG 3 cut(s) 164, 165, 328
BssMI GATC 1 cut(s) 317
BssT1I CCWWGG 1 cut(s) 328
Bst2UI CCWGG 1 cut(s) 166
Bst4CI ACNGT 1 cut(s) 349
Bst6I CTCTTC 1 cut(s) 283
BstC8I GCNNGC 1 cut(s) 115
BstF5I GGATG 1 cut(s) 222
BstKTI GATC 1 cut(s) 320
BstMAI GTCTC 1 cut(s) 338
BstMBI GATC 1 cut(s) 317
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstNI CCWGG 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 164
BstX2I RGATCY 1 cut(s) 317
BstYI RGATCY 1 cut(s) 317
BtsCI GGATG 1 cut(s) 222
BtsI GCAGTG 1 cut(s) 237
BtsIMutI CAGTG 1 cut(s) 237
Cac8I GCNNGC 1 cut(s) 115
CaiI CAGNNNCTG 1 cut(s) 347
CviAII CATG 2 cut(s) 120, 125
CviJI RGCY 3 cut(s) 28, 89, 230
CviKI_1 RGCY 3 cut(s) 28, 89, 230
DpnI GATC 1 cut(s) 319
DpnII GATC 1 cut(s) 317
Eam1104I CTCTTC 1 cut(s) 283
EarI CTCTTC 1 cut(s) 283
Eco130I CCWWGG 1 cut(s) 328
EcoRI GAATTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 164
EcoT14I CCWWGG 1 cut(s) 328
ErhI CCWWGG 1 cut(s) 328
FaeI CATG 2 cut(s) 123, 128
FaiI YATR 5 cut(s) 6, 111, 121, 126, 146
FalI AAGNNNNNCTT 2 cut(s) 91, 123
FatI CATG 2 cut(s) 119, 124
FokI GGATG 1 cut(s) 229
FspBI CTAG 2 cut(s) 131, 358
HapII CCGG 1 cut(s) 321
Hin1II CATG 2 cut(s) 123, 128
HinfI GANTC 3 cut(s) 71, 207, 223
HpaII CCGG 1 cut(s) 321
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 343
Hpy188III TCNNGA 1 cut(s) 248
Hpy8I GTNNAC 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 349
HpyCH4V TGCA 2 cut(s) 45, 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
Hsp92II CATG 2 cut(s) 123, 128
Kzo9I GATC 1 cut(s) 317
LpnPI CCDG 7 cut(s) 10, 127, 151, 178, 233, 240, 334
LweI GCATC 1 cut(s) 207
MaeI CTAG 2 cut(s) 131, 358
MalI GATC 1 cut(s) 319
MboI GATC 1 cut(s) 317
MboII GAAGA 4 cut(s) 111, 196, 216, 300
MflI RGATCY 1 cut(s) 317
MluCI AATT 3 cut(s) 102, 298, 312
MmeI TCCRAC 1 cut(s) 181
MnlI CCTC 1 cut(s) 346
MspI CCGG 1 cut(s) 321
MspR9I CCNGG 1 cut(s) 166
Mva1269I GAATGC 1 cut(s) 193
MvaI CCWGG 1 cut(s) 166
MwoI GCNNNNNNNGC 1 cut(s) 25
NdeII GATC 1 cut(s) 317
NlaIII CATG 2 cut(s) 123, 128
NlaIV GGNNCC 1 cut(s) 319
NspI RCATGY 1 cut(s) 128
PasI CCCWGGG 1 cut(s) 165
PctI GAATGC 1 cut(s) 193
PfeI GAWTC 3 cut(s) 71, 207, 223
PflMI CCANNNNNTGG 1 cut(s) 120
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspN4I GGNNCC 1 cut(s) 319
PstNI CAGNNNCTG 1 cut(s) 347
PsuI RGATCY 1 cut(s) 317
Sau3AI GATC 1 cut(s) 317
ScrFI CCNGG 1 cut(s) 166
SetI ASST 1 cut(s) 142
SfaNI GCATC 1 cut(s) 207
Sse9I AATT 3 cut(s) 102, 298, 312
SspMI CTAG 2 cut(s) 131, 358
StyD4I CCNGG 1 cut(s) 164
StyI CCWWGG 1 cut(s) 328
TaaI ACNGT 1 cut(s) 349
TasI AATT 3 cut(s) 102, 298, 312
TfiI GAWTC 3 cut(s) 71, 207, 223
TscAI CASTG 1 cut(s) 244
TspRI CASTG 1 cut(s) 244
Van91I CCANNNNNTGG 1 cut(s) 120
XapI RAATTY 1 cut(s) 102
XceI RCATGY 1 cut(s) 128
XspI CTAG 2 cut(s) 131, 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.