Rh2DG347500

Pentatricopeptide repeat-containing protein At2g20710, mitochondrial-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
48069645 .. 48088698
19054 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG347500.1

Sequence Viewer

Length: 336 bp
ATGCTGGATGATATTAAGGAAGCTGAGAGGATATTTGAGGAGTGGGAGTCACAGTGCAAAATGTATGACTTTCGGGTGCTGAACAGGCTTCTTATTGTCTATTGCAAAATGGGTCTTTTGGACAAGGCAGAATCACTTGTAAACAAGGCTGTGGAAGGAAGAATTCCTTATGCCAGCACATGGCATGTGCTAGTAATAGGTTTTATGGAGAATAAGCAGATACCCAGGGCAGTTGAGATGTTGAAGAATGCACTTTCAGTTGGTAGATTCGGGTGGATGCCGAATCCAGCCACTTTCACTGCCTTTCTGGATTATTTGGAATGGAAAGGATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.97

Weight (kDa)

5.83

Isoelectric Point (pI)

36.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018494)

Species Orthologous Gene IDs
malus_domestica MD09G1248900.v1.1
prunus_persica Prupe.3G136700_v2.0.a1
pyrus_communis pycom09g16580
rosa_chinensis RchiOBHm_Chr2g0126311
rosa_laevigata RLG00000018900
rosa_multiflora Rmu_ssc0000264.1_g000039
rosa_roxburghii Rroxscaffold_2G00117250
rosa_samantha Rh2AG319400 Rh2BG327800 Rh2DG347500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 180
AcsI RAATTY 1 cut(s) 162
AfiI CCNNNNNNNGG 1 cut(s) 180
AgsI TTSAA 1 cut(s) 244
AjnI CCWGG 1 cut(s) 224
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
ApoI RAATTY 1 cut(s) 162
BciT130I CCWGG 1 cut(s) 226
BfaI CTAG 1 cut(s) 191
Bme1390I CCNGG 1 cut(s) 226
BmrFI CCNGG 1 cut(s) 226
BmsI GCATC 1 cut(s) 267
BsaJI CCNNGG 2 cut(s) 224, 225
BsaXI ACNNNNNCTCC 4 cut(s) 32, 38, 62, 68
Bsc4I CCNNNNNNNGG 1 cut(s) 180
BseBI CCWGG 1 cut(s) 226
BseDI CCNNGG 2 cut(s) 224, 225
BseGI GGATG 3 cut(s) 13, 282, 335
BseLI CCNNNNNNNGG 1 cut(s) 180
BseMII CTCAG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 180
BsmI GAATGC 1 cut(s) 253
BspCNI CTCAG 1 cut(s) 16
BssECI CCNNGG 2 cut(s) 224, 225
Bst2UI CCWGG 1 cut(s) 226
Bst4CI ACNGT 1 cut(s) 54
BstC8I GCNNGC 1 cut(s) 175
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 3 cut(s) 13, 282, 335
BstMWI GCNNNNNNNGC 1 cut(s) 85
BstNI CCWGG 1 cut(s) 226
BstNSI RCATGY 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 224
BtsCI GGATG 3 cut(s) 13, 282, 335
BtsI GCAGTG 1 cut(s) 297
BtsIMutI CAGTG 2 cut(s) 59, 297
Cac8I GCNNGC 1 cut(s) 175
CviAII CATG 2 cut(s) 180, 185
CviJI RGCY 4 cut(s) 23, 88, 149, 290
CviKI_1 RGCY 4 cut(s) 23, 88, 149, 290
DdeI CTNAG 1 cut(s) 24
EcoRI GAATTC 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 224
FaeI CATG 2 cut(s) 183, 188
FaiI YATR 5 cut(s) 66, 171, 181, 186, 206
FalI AAGNNNNNCTT 2 cut(s) 151, 183
FatI CATG 2 cut(s) 179, 184
FokI GGATG 2 cut(s) 20, 289
FspBI CTAG 1 cut(s) 191
Hin1II CATG 2 cut(s) 183, 188
HinfI GANTC 4 cut(s) 47, 131, 267, 283
Hpy166II GTNNAC 1 cut(s) 142
Hpy188III TCNNGA 1 cut(s) 308
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 54
HpyCH4V TGCA 3 cut(s) 57, 105, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 2 cut(s) 183, 188
LpnPI CCDG 6 cut(s) 70, 187, 211, 238, 293, 300
LweI GCATC 1 cut(s) 267
MaeI CTAG 1 cut(s) 191
MaeIII GTNAC 1 cut(s) 48
MboII GAAGA 2 cut(s) 171, 256
MluCI AATT 1 cut(s) 162
MlyI GAGTC 1 cut(s) 56
MnlI CCTC 2 cut(s) 21, 31
MseI TTAA 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 226
Mva1269I GAATGC 1 cut(s) 253
MvaI CCWGG 1 cut(s) 226
MwoI GCNNNNNNNGC 1 cut(s) 85
NlaIII CATG 2 cut(s) 183, 188
NmuCI GTSAC 1 cut(s) 48
NspI RCATGY 1 cut(s) 188
PasI CCCWGGG 1 cut(s) 225
PctI GAATGC 1 cut(s) 253
PfeI GAWTC 3 cut(s) 131, 267, 283
PflMI CCANNNNNTGG 1 cut(s) 180
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 224
PspGI CCWGG 1 cut(s) 224
SaqAI TTAA 1 cut(s) 15
SchI GAGTC 1 cut(s) 56
ScrFI CCNGG 1 cut(s) 226
SetI ASST 2 cut(s) 25, 202
SfaNI GCATC 1 cut(s) 267
Sse9I AATT 1 cut(s) 162
SspMI CTAG 1 cut(s) 191
StyD4I CCNGG 1 cut(s) 224
TaaI ACNGT 1 cut(s) 54
TasI AATT 1 cut(s) 162
TfiI GAWTC 3 cut(s) 131, 267, 283
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TscAI CASTG 2 cut(s) 59, 304
TseFI GTSAC 1 cut(s) 48
Tsp45I GTSAC 1 cut(s) 48
TspRI CASTG 2 cut(s) 59, 304
Van91I CCANNNNNTGG 1 cut(s) 180
XapI RAATTY 1 cut(s) 162
XceI RCATGY 1 cut(s) 188
XspI CTAG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.