Rmu_ssc0000410.1_g000039

Cytochrome p450

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000410.1
OG0018892
Physical Location & Seq
Reverse (-)
233408 .. 233788
381 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 381 bp
atgcgtgccaacactgcagaggattggcttgaacaaaggatcagaaagtatggtccagtttcaaagctaagtctctttggcaagccaacagtcttcatccatggacaagctgcaaacaagtttatattcaccagtgatgggagcaccatttcagcccaacaaaccgagtctattcgtaggattttgggggaacggagtatatccgagttaagtgctgaggatcacaaacgtgtcagaagtgcacttatgctattcttgaagcctgagtcactgaagcaatatgtgtggaaaatggatgaagaaatcaggaagcaccttgagatacactggcatggcaaacagcaagtaacagtgagttacctctttatcacactccactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00830 ko01100 map00830 map01100
Pfam Domains
Protein Families
p450

Protein Analysis

126

Amino Acids

14.7

Weight (kDa)

9.64

Isoelectric Point (pI)

51.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018892)

Species Orthologous Gene IDs
malus_domestica MD03G1183000.v1.1 MD03G1204900.v1.1
rosa_multiflora Rmu_ssc0000410.1_g000039
rosa_roxburghii Rroxscaffold_1G00040340 Rroxscaffold_1G00041970
rosa_rugosa Rorug05G0176700
rosa_samantha Rh5BG268000 Rh5DG274800 Rh5DG275800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 47, 228
AcuI CTGAAG 1 cut(s) 293
AfiI CCNNNNNNNGG 1 cut(s) 138
AflIII ACRYGT 1 cut(s) 229
AgsI TTSAA 3 cut(s) 32, 63, 259
AleI CACNNNNGTG 1 cut(s) 228
AluBI AGCT 2 cut(s) 67, 110
AluI AGCT 2 cut(s) 67, 110
Alw21I GWGCWC 2 cut(s) 146, 244
Alw26I GTCTC 1 cut(s) 77
Alw44I GTGCAC 1 cut(s) 240
AlwI GGATC 2 cut(s) 47, 228
ApaLI GTGCAC 1 cut(s) 240
ApeKI GCWGC 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 53
AsuHPI GGTGA 1 cut(s) 121
AvaII GGWCC 1 cut(s) 53
BaeGI GKGCMC 1 cut(s) 244
BbsI GAAGAC 1 cut(s) 85
Bbv12I GWGCWC 2 cut(s) 146, 244
BbvCI CCTCAGC 1 cut(s) 216
BbvI GCAGC 1 cut(s) 97
BccI CCATC 1 cut(s) 131
BcgI CGANNNNNNTGC 2 cut(s) 194, 228
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 1 cut(s) 379
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BpiI GAAGAC 1 cut(s) 85
Bpu10I CCTNAGC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 338
BsaJI CCNNGG 1 cut(s) 100
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse1I ACTGG 3 cut(s) 56, 132, 332
BseDI CCNNGG 1 cut(s) 100
BseGI GGATG 2 cut(s) 96, 301
BseLI CCNNNNNNNGG 1 cut(s) 138
BseMII CTCAG 2 cut(s) 207, 255
BseNI ACTGG 3 cut(s) 56, 132, 332
BseSI GKGCMC 1 cut(s) 244
BseXI GCAGC 1 cut(s) 97
BsiHKAI GWGCWC 2 cut(s) 146, 244
BslI CCNNNNNNNGG 1 cut(s) 138
BsmAI GTCTC 1 cut(s) 77
Bsp1286I GDGCHC 2 cut(s) 146, 244
Bsp143I GATC 2 cut(s) 39, 220
Bsp19I CCATGG 1 cut(s) 100
BspCNI CTCAG 2 cut(s) 208, 256
BspMAI CTGCAG 1 cut(s) 19
BspPI GGATC 2 cut(s) 47, 228
BsrI ACTGG 3 cut(s) 56, 132, 332
BssECI CCNNGG 1 cut(s) 100
BssMI GATC 2 cut(s) 39, 220
BssT1I CCWWGG 1 cut(s) 100
Bst4CI ACNGT 2 cut(s) 91, 352
BstC8I GCNNGC 2 cut(s) 6, 83
BstDEI CTNAG 3 cut(s) 68, 216, 264
BstDSI CCRYGG 1 cut(s) 100
BstF5I GGATG 2 cut(s) 96, 301
BstKTI GATC 2 cut(s) 42, 223
BstMAI GTCTC 1 cut(s) 77
BstMBI GATC 2 cut(s) 39, 220
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstSFI CTRYAG 1 cut(s) 15
BstSLI GKGCMC 1 cut(s) 244
BstV1I GCAGC 1 cut(s) 97
BstV2I GAAGAC 1 cut(s) 85
BtgI CCRYGG 1 cut(s) 100
BtsCI GGATG 2 cut(s) 96, 301
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 5 cut(s) 12, 139, 269, 325, 357
Cac8I GCNNGC 2 cut(s) 6, 83
Cfr13I GGNCC 1 cut(s) 53
CspCI CAANNNNNGTGG 2 cut(s) 266, 301
CviAII CATG 2 cut(s) 101, 332
CviJI RGCY 6 cut(s) 28, 67, 85, 110, 155, 262
CviKI_1 RGCY 6 cut(s) 28, 67, 85, 110, 155, 262
DdeI CTNAG 3 cut(s) 68, 216, 264
DpnI GATC 2 cut(s) 41, 222
DpnII GATC 2 cut(s) 39, 220
Eco130I CCWWGG 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 293
EcoT14I CCWWGG 1 cut(s) 100
ErhI CCWWGG 1 cut(s) 100
FaeI CATG 2 cut(s) 104, 335
FaiI YATR 7 cut(s) 51, 102, 125, 200, 248, 282, 333
FatI CATG 2 cut(s) 100, 331
Fnu4HI GCNGC 1 cut(s) 111
FokI GGATG 2 cut(s) 83, 308
Fsp4HI GCNGC 1 cut(s) 111
FspBI CTAG 1 cut(s) 379
GluI GCNGC 1 cut(s) 111
Hin1II CATG 2 cut(s) 104, 335
HinfI GANTC 2 cut(s) 167, 266
HphI GGTGA 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 242
Hpy188I TCNGA 3 cut(s) 44, 205, 236
Hpy188III TCNNGA 2 cut(s) 256, 307
Hpy8I GTNNAC 1 cut(s) 242
HpyCH4III ACNGT 2 cut(s) 91, 352
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 3 cut(s) 17, 113, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
HpyF3I CTNAG 3 cut(s) 68, 216, 264
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 2 cut(s) 104, 335
Kzo9I GATC 2 cut(s) 39, 220
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 5 cut(s) 69, 145, 276, 292, 313
Lsp1109I GCAGC 1 cut(s) 97
MaeI CTAG 1 cut(s) 379
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 3 cut(s) 267, 346, 356
MalI GATC 2 cut(s) 41, 222
MboI GATC 2 cut(s) 39, 220
MboII GAAGA 2 cut(s) 85, 311
MhlI GDGCHC 2 cut(s) 146, 244
MlyI GAGTC 2 cut(s) 176, 275
MnlI CCTC 3 cut(s) 13, 211, 371
MseI TTAA 1 cut(s) 209
MslI CAYNNNNRTG 2 cut(s) 228, 330
MwoI GCNNNNNNNGC 1 cut(s) 14
NcoI CCATGG 1 cut(s) 100
NdeII GATC 2 cut(s) 39, 220
NlaIII CATG 2 cut(s) 104, 335
NmuCI GTSAC 1 cut(s) 267
OliI CACNNNNGTG 1 cut(s) 228
PkrI GCNGC 1 cut(s) 112
PleI GAGTC 2 cut(s) 175, 274
PpsI GAGTC 2 cut(s) 175, 274
PspPI GGNCC 1 cut(s) 53
PstI CTGCAG 1 cut(s) 19
RseI CAYNNNNRTG 2 cut(s) 228, 330
SaqAI TTAA 1 cut(s) 209
SatI GCNGC 1 cut(s) 111
Sau3AI GATC 2 cut(s) 39, 220
Sau96I GGNCC 1 cut(s) 53
SchI GAGTC 2 cut(s) 176, 275
SduI GDGCHC 2 cut(s) 146, 244
SetI ASST 5 cut(s) 69, 112, 232, 318, 363
SfcI CTRYAG 1 cut(s) 15
SinI GGWCC 1 cut(s) 53
SmiMI CAYNNNNRTG 2 cut(s) 228, 330
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
SspMI CTAG 1 cut(s) 379
StyI CCWWGG 1 cut(s) 100
TaaI ACNGT 2 cut(s) 91, 352
TaiI ACGT 1 cut(s) 232
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TscAI CASTG 5 cut(s) 19, 139, 276, 332, 357
TseFI GTSAC 1 cut(s) 267
TseI GCWGC 1 cut(s) 110
Tsp45I GTSAC 1 cut(s) 267
TspDTI ATGAA 2 cut(s) 85, 312
TspGWI ACGGA 1 cut(s) 208
TspRI CASTG 5 cut(s) 19, 139, 276, 332, 357
VneI GTGCAC 1 cut(s) 240
VpaK11BI GGWCC 1 cut(s) 53
XspI CTAG 1 cut(s) 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.