Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000454.1

Orthogroup ID

OG0018641

Physical Location & Seq

Genomic Coordinates Forward (+)

94435 .. 94794

Gene Structure 360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000454.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atgctacaaatctttccaacaagtgtggtgaaactatggaacgagacatatggagtcatggagtcacaactgctacatactgcctactcaatggagaactctgaactttggctaacacatttactagacttcgtagtccaggttggactggctttctatgtctttgtatggatagctagcacttaccatctactgttagttataccagtgtttgttgctggagttatcaagtatggagagaggacttgggtcctgcagtctacgagcagcaagaagcttgctgactccctgcttctaccttcttatcctaggaataattgtgctaattttgaggagaaatatagcactataaaagcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4220 DUF594

Protein Analysis

119

Amino Acids

13.65

Weight (kDa)

6.26

Isoelectric Point (pI)

35.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018641)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr7g0216491
rosa_multiflora	Rmu_sc0001970.1_g000012 Rmu_sc0016089.1_g000004 Rmu_ssc0000454.1_g000024
rosa_roxburghii	Rroxscaffold_2G00098870
rosa_samantha	Rh2BG250800 Rh2DG623000 Rh3BG354600 Rh3CG351500 Rh7BG291400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	134
AccI	GTMKAC	1 cut(s)	260
AjnI	CCWGG	1 cut(s)	138
AluBI	AGCT	3 cut(s)	176, 277, 356
AluI	AGCT	3 cut(s)	176, 277, 356
Alw26I	GTCTC	1 cut(s)	38
ApeKI	GCWGC	1 cut(s)	267
AspA2I	CCTAGG	1 cut(s)	308
AspS9I	GGNCC	1 cut(s)	250
AsuHPI	GGTGA	1 cut(s)	40
AsuNHI	GCTAGC	1 cut(s)	176
AvaII	GGWCC	1 cut(s)	250
AvrII	CCTAGG	1 cut(s)	308
BbvI	GCAGC	1 cut(s)	279
BccI	CCATC	1 cut(s)	195
BciT130I	CCWGG	1 cut(s)	140
BcoDI	GTCTC	1 cut(s)	38
BfaI	CTAG	3 cut(s)	125, 177, 309
BfmI	CTRYAG	1 cut(s)	254
BisI	GCNGC	1 cut(s)	268
BlnI	CCTAGG	1 cut(s)	308
BlsI	GCNGC	1 cut(s)	269
Bme1390I	CCNGG	1 cut(s)	140
Bme18I	GGWCC	1 cut(s)	250
BmgT120I	GGNCC	1 cut(s)	250
BmiI	GGNNCC	1 cut(s)	251
BmrFI	CCNGG	1 cut(s)	140
BmtI	GCTAGC	1 cut(s)	180
BoxI	GACNNNNGTC	1 cut(s)	248
BpmI	CTGGAG	1 cut(s)	240
BsaJI	CCNNGG	1 cut(s)	308
Bse1I	ACTGG	2 cut(s)	153, 206
BseBI	CCWGG	1 cut(s)	140
BseDI	CCNNGG	1 cut(s)	308
BseNI	ACTGG	2 cut(s)	153, 206
BseRI	GAGGAG	1 cut(s)	347
BseXI	GCAGC	1 cut(s)	279
BsmAI	GTCTC	1 cut(s)	38
BspLI	GGNNCC	1 cut(s)	251
BspMAI	CTGCAG	1 cut(s)	258
BspOI	GCTAGC	1 cut(s)	180
BsrI	ACTGG	2 cut(s)	153, 206
BssECI	CCNNGG	1 cut(s)	308
BssT1I	CCWWGG	1 cut(s)	308
Bst2UI	CCWGG	1 cut(s)	140
Bst4CI	ACNGT	1 cut(s)	195
BstC8I	GCNNGC	2 cut(s)	178, 279
BstMAI	GTCTC	1 cut(s)	38
BstNI	CCWGG	1 cut(s)	140
BstPAI	GACNNNNGTC	1 cut(s)	248
BstSCI	CCNGG	1 cut(s)	138
BstSFI	CTRYAG	1 cut(s)	254
BstV1I	GCAGC	1 cut(s)	279
BtsIMutI	CAGTG	1 cut(s)	213
Cac8I	GCNNGC	2 cut(s)	178, 279
Cfr13I	GGNCC	1 cut(s)	250
CspCI	CAANNNNNGTGG	2 cut(s)	6, 41
CviAII	CATG	1 cut(s)	58
CviJI	RGCY	5 cut(s)	112, 152, 176, 277, 356
CviKI_1	RGCY	5 cut(s)	112, 152, 176, 277, 356
DrdI	GACNNNNNNGTC	1 cut(s)	134
DseDI	GACNNNNNNGTC	1 cut(s)	134
Eco130I	CCWWGG	1 cut(s)	308
Eco47I	GGWCC	1 cut(s)	250
EcoO109I	RGGNCCY	1 cut(s)	250
EcoRII	CCWGG	1 cut(s)	138
EcoT14I	CCWWGG	1 cut(s)	308
ErhI	CCWWGG	1 cut(s)	308
FaeI	CATG	1 cut(s)	61
FatI	CATG	1 cut(s)	57
FauNDI	CATATG	1 cut(s)	49
FblI	GTMKAC	1 cut(s)	260
Fnu4HI	GCNGC	1 cut(s)	268
Fsp4HI	GCNGC	1 cut(s)	268
FspBI	CTAG	3 cut(s)	125, 177, 309
GluI	GCNGC	1 cut(s)	268
GsuI	CTGGAG	1 cut(s)	240
Hin1II	CATG	1 cut(s)	61
HindIII	AAGCTT	2 cut(s)	275, 354
HinfI	GANTC	3 cut(s)	54, 62, 284
HphI	GGTGA	1 cut(s)	40
Hpy166II	GTNNAC	1 cut(s)	261
Hpy188I	TCNGA	1 cut(s)	103
Hpy8I	GTNNAC	1 cut(s)	261
HpyAV	CCTTC	1 cut(s)	309
HpyCH4III	ACNGT	1 cut(s)	195
HpyCH4V	TGCA	1 cut(s)	256
Hsp92II	CATG	1 cut(s)	61
LpnPI	CCDG	7 cut(s)	125, 134, 152, 204, 219, 266, 302
Lsp1109I	GCAGC	1 cut(s)	279
MaeI	CTAG	3 cut(s)	125, 177, 309
MaeIII	GTNAC	1 cut(s)	63
MluCI	AATT	2 cut(s)	316, 325
MlyI	GAGTC	3 cut(s)	63, 71, 278
MmeI	TCCRAC	2 cut(s)	41, 124
MnlI	CCTC	2 cut(s)	234, 325
MspR9I	CCNGG	1 cut(s)	140
MvaI	CCWGG	1 cut(s)	140
NdeI	CATATG	1 cut(s)	49
NheI	GCTAGC	1 cut(s)	176
NlaIII	CATG	1 cut(s)	61
NlaIV	GGNNCC	1 cut(s)	251
NmuCI	GTSAC	1 cut(s)	63
PkrI	GCNGC	1 cut(s)	269
PleI	GAGTC	3 cut(s)	62, 70, 278
PpsI	GAGTC	3 cut(s)	62, 70, 278
PpuMI	RGGWCCY	1 cut(s)	250
PshAI	GACNNNNGTC	1 cut(s)	248
Psp5II	RGGWCCY	1 cut(s)	250
Psp6I	CCWGG	1 cut(s)	138
PspGI	CCWGG	1 cut(s)	138
PspN4I	GGNNCC	1 cut(s)	251
PspPI	GGNCC	1 cut(s)	250
PspPPI	RGGWCCY	1 cut(s)	250
PstI	CTGCAG	1 cut(s)	258
SatI	GCNGC	1 cut(s)	268
Sau96I	GGNCC	1 cut(s)	250
SchI	GAGTC	3 cut(s)	63, 71, 278
ScrFI	CCNGG	1 cut(s)	140
SetI	ASST	5 cut(s)	144, 178, 279, 301, 358
SfcI	CTRYAG	1 cut(s)	254
SinI	GGWCC	1 cut(s)	250
Sse9I	AATT	2 cut(s)	316, 325
SspMI	CTAG	3 cut(s)	125, 177, 309
StyD4I	CCNGG	1 cut(s)	138
StyI	CCWWGG	1 cut(s)	308
TaaI	ACNGT	1 cut(s)	195
TasI	AATT	2 cut(s)	316, 325
TscAI	CASTG	1 cut(s)	213
TseFI	GTSAC	1 cut(s)	63
TseI	GCWGC	1 cut(s)	267
Tsp45I	GTSAC	1 cut(s)	63
TspRI	CASTG	1 cut(s)	213
VpaK11BI	GGWCC	1 cut(s)	250
XmaJI	CCTAGG	1 cut(s)	308
XmiI	GTMKAC	1 cut(s)	260
XspI	CTAG	3 cut(s)	125, 177, 309

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.