Rh2DG623000

Domain of unknown function (DUF4220)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0018641
Physical Location & Seq
Reverse (-)
85278901 .. 85279658
758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG623000.1

Sequence Viewer

Length: 348 bp
ATGAGACCAGTGATCTTTTGGTATTTTTGGACTCCCTTTATTTTGTTACACCTTGGGGGTCCAGACACCATCACTGCTTTTGCTCTGGAAAATGATACCCTGTGGCTAAGGCACTTGCTTGGCCTCGTTTTCCAGGTTATAGCTTCTGTTTATGTCTTCCATCAATCACTCCCGAATAAGCTGTGGCTCCCAATAAGGTATCTCTTTGTTGCTGGAATCATCAAGTATGCAGAGAGAACACGTGCTTTGTATCTTACAATCTTGGAAACTTCAAGGAATCCATGCTTAAAAAGCCTAATGCTGGACCCAACTATGGGAATCTCATGGAAGAATACTCCTCAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4220 DUF594

Protein Analysis

115

Amino Acids

13.41

Weight (kDa)

9.51

Isoelectric Point (pI)

37.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4220 PF13968 8 - 92 4.5e-31 Domain of unknown function (DUF4220)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcvI CACGTG 1 cut(s) 242
AfiI CCNNNNNNNGG 3 cut(s) 301, 313, 314
AflIII ACRYGT 1 cut(s) 239
AgsI TTSAA 1 cut(s) 273
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 3 cut(s) 143, 181, 345
AluI AGCT 3 cut(s) 143, 181, 345
AoxI GGCC 1 cut(s) 121
AspS9I GGNCC 2 cut(s) 59, 304
AvaII GGWCC 2 cut(s) 59, 304
BbrPI CACGTG 1 cut(s) 242
BbsI GAAGAC 1 cut(s) 148
BccI CCATC 2 cut(s) 77, 168
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 346
Bme1390I CCNGG 1 cut(s) 134
Bme18I GGWCC 2 cut(s) 59, 304
BmgT120I GGNCC 2 cut(s) 59, 304
BmiI GGNNCC 3 cut(s) 60, 188, 306
BmrFI CCNGG 1 cut(s) 134
BpiI GAAGAC 1 cut(s) 148
Bpu10I CCTNAGC 1 cut(s) 107
BsaAI YACGTR 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 52
Bsc4I CCNNNNNNNGG 3 cut(s) 301, 313, 314
Bse1I ACTGG 1 cut(s) 8
BseBI CCWGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 52
BseLI CCNNNNNNNGG 3 cut(s) 301, 313, 314
BseNI ACTGG 1 cut(s) 8
BseRI GAGGAG 1 cut(s) 327
BshFI GGCC 1 cut(s) 123
BslI CCNNNNNNNGG 3 cut(s) 301, 313, 314
BsnI GGCC 1 cut(s) 123
Bsp143I GATC 1 cut(s) 12
BspANI GGCC 1 cut(s) 123
BspLI GGNNCC 3 cut(s) 60, 188, 306
BsrI ACTGG 1 cut(s) 8
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 134
BstBAI YACGTR 1 cut(s) 242
BstDEI CTNAG 1 cut(s) 107
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstMWI GCNNNNNNNGC 1 cut(s) 291
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstV2I GAAGAC 1 cut(s) 148
BsuRI GGCC 1 cut(s) 123
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 2 cut(s) 15, 72
Cfr13I GGNCC 2 cut(s) 59, 304
CviAII CATG 2 cut(s) 282, 324
CviJI RGCY 7 cut(s) 106, 123, 143, 181, 187, 294, 345
CviKI_1 RGCY 7 cut(s) 106, 123, 143, 181, 187, 294, 345
DdeI CTNAG 1 cut(s) 107
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
Eco130I CCWWGG 1 cut(s) 52
Eco47I GGWCC 2 cut(s) 59, 304
Eco72I CACGTG 1 cut(s) 242
EcoRII CCWGG 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 52
ErhI CCWWGG 1 cut(s) 52
FaeI CATG 2 cut(s) 285, 327
FaiI YATR 6 cut(s) 140, 153, 228, 283, 314, 325
FatI CATG 2 cut(s) 281, 323
FspBI CTAG 1 cut(s) 346
HaeIII GGCC 1 cut(s) 123
Hin1II CATG 2 cut(s) 285, 327
HinfI GANTC 4 cut(s) 31, 216, 277, 318
Hpy188III TCNNGA 3 cut(s) 62, 86, 172
HpyCH4IV ACGT 1 cut(s) 241
HpyCH4V TGCA 1 cut(s) 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 291
HpyF3I CTNAG 1 cut(s) 107
HpySE526I ACGT 1 cut(s) 241
Hsp92II CATG 2 cut(s) 285, 327
Kzo9I GATC 1 cut(s) 12
LmnI GCTCC 1 cut(s) 192
LpnPI CCDG 8 cut(s) 21, 71, 75, 113, 119, 146, 198, 287
MaeI CTAG 1 cut(s) 346
MaeII ACGT 1 cut(s) 241
MaeIII GTNAC 1 cut(s) 45
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MboII GAAGA 2 cut(s) 148, 340
MlyI GAGTC 1 cut(s) 25
MnlI CCTC 2 cut(s) 134, 348
MseI TTAA 1 cut(s) 287
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 291
NdeII GATC 1 cut(s) 12
NlaIII CATG 2 cut(s) 285, 327
NlaIV GGNNCC 3 cut(s) 60, 188, 306
PfeI GAWTC 3 cut(s) 216, 277, 318
PleI GAGTC 1 cut(s) 25
PmaCI CACGTG 1 cut(s) 242
PmlI CACGTG 1 cut(s) 242
PpsI GAGTC 1 cut(s) 25
Ppu21I YACGTR 1 cut(s) 242
Psp6I CCWGG 1 cut(s) 132
PspCI CACGTG 1 cut(s) 242
PspGI CCWGG 1 cut(s) 132
PspN4I GGNNCC 3 cut(s) 60, 188, 306
PspPI GGNCC 2 cut(s) 59, 304
SaqAI TTAA 1 cut(s) 287
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 2 cut(s) 59, 304
SchI GAGTC 1 cut(s) 25
ScrFI CCNGG 1 cut(s) 134
SetI ASST 7 cut(s) 54, 138, 145, 183, 200, 244, 347
SinI GGWCC 2 cut(s) 59, 304
SspMI CTAG 1 cut(s) 346
StyD4I CCNGG 1 cut(s) 132
StyI CCWWGG 1 cut(s) 52
TaiI ACGT 1 cut(s) 244
TfiI GAWTC 3 cut(s) 216, 277, 318
Tru1I TTAA 1 cut(s) 287
Tru9I TTAA 1 cut(s) 287
TscAI CASTG 2 cut(s) 15, 79
TspRI CASTG 2 cut(s) 15, 79
VpaK11BI GGWCC 2 cut(s) 59, 304
XcmI CCANNNNNNNNNTGG 1 cut(s) 15
XspI CTAG 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.