Rmu_ssc0000460.1_g000009

Alkaline and neutral invertase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000460.1
OG0016415
Physical Location & Seq
Reverse (-)
48839 .. 49801
963 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 813 bp
atggctttgagatgtgcttgcttcctgctcaagcaagacaatgtgggtaaggaatttgtagagaggataactgatcgtctccatgctttgagctttcacatgcggagctatttctggctggacctgaagcagctcaatgatatatatcgctataaaacagaggagtattctcacacagcagtgaacaagttcaatgtaatgcccgattcgcttccggattgggtgttcgatttcataccgagtcgtggtggctacttcatcggaaatgtgagccctgcgagaatggatttccggtggttctgtttgggtaattgtgtggcgattctgtcgtctctggcaacccctgagcaatctgcagccataatggaccttattgaagaacgttgggatgatctggtcggagaaatgcctttgaaaatttgttatccgaccattgaaagccatgagtatctaattgtcaccggctgtgaccccaagaacactaagtggagttaccacaatgggggctcttggccagtgcttctatggctgttgacagcggcatgtataaagacgggacgtccccaaattgccaggcgtgcgattgatctgactgaaagccggttgtcgaaagaccactggccagagtactatgatggcaagtcggggaggtacattggaaagcaagcacggaagttccaaacatggtccattgcaggctacttggtggcgaagatgatgttggatgatccttctcatttggggatgatatcactagaggaagataagcaaatgaagccccttataaaaagatctgcttcatggacatcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_100

Protein Analysis

270

Amino Acids

31.26

Weight (kDa)

7.6

Isoelectric Point (pI)

53.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_100 PF12899 1 - 244 9.4e-122 Alkaline and neutral invertase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 785
AatII GACGTC 1 cut(s) 562
AccIII TCCGGA 1 cut(s) 214
AciI CCGC 2 cut(s) 103, 539
AclI AACGTT 1 cut(s) 382
AclWI GGATC 1 cut(s) 722
AcoI YGGCCR 2 cut(s) 512, 620
AcsI RAATTY 2 cut(s) 53, 417
AcuI CTGAAG 1 cut(s) 146
AcyI GRCGYC 1 cut(s) 559
AdeI CACNNNGTG 1 cut(s) 486
AfaI GTAC 2 cut(s) 629, 653
AfiI CCNNNNNNNGG 2 cut(s) 245, 502
AgsI TTSAA 4 cut(s) 193, 377, 415, 437
AhdI GACNNNNNGTC 1 cut(s) 558
AjnI CCWGG 1 cut(s) 572
AjuI GAANNNNNNNTTGG 2 cut(s) 704, 736
AleI CACNNNNGTG 1 cut(s) 179
AloI GAACNNNNNNTCC 2 cut(s) 209, 241
AluBI AGCT 3 cut(s) 93, 108, 133
AluI AGCT 3 cut(s) 93, 108, 133
Alw26I GTCTC 2 cut(s) 83, 336
AlwI GGATC 1 cut(s) 722
Aor13HI TCCGGA 1 cut(s) 214
AoxI GGCC 2 cut(s) 512, 620
ApeKI GCWGC 2 cut(s) 130, 356
ApoI RAATTY 2 cut(s) 53, 417
Asp700I GAANNNNTTC 1 cut(s) 188
AspS9I GGNCC 3 cut(s) 121, 367, 687
AsuHPI GGTGA 1 cut(s) 451
AvaII GGWCC 3 cut(s) 121, 367, 687
BalI TGGCCA 2 cut(s) 514, 622
BanII GRGCYC 2 cut(s) 275, 509
BbvI GCAGC 2 cut(s) 142, 368
BccI CCATC 1 cut(s) 629
BciT130I CCWGG 1 cut(s) 574
BcoDI GTCTC 2 cut(s) 83, 336
BfaI CTAG 1 cut(s) 755
BfmI CTRYAG 1 cut(s) 354
BglII AGATCT 1 cut(s) 791
BisI GCNGC 3 cut(s) 131, 357, 540
BlsI GCNGC 3 cut(s) 132, 358, 541
BmcAI AGTACT 1 cut(s) 629
Bme1390I CCNGG 1 cut(s) 574
Bme18I GGWCC 3 cut(s) 121, 367, 687
BmeRI GACNNNNNGTC 1 cut(s) 558
BmgT120I GGNCC 3 cut(s) 121, 367, 687
BmrFI CCNGG 1 cut(s) 574
Bpu10I CCTNAGC 1 cut(s) 345
BpuEI CTTGAG 1 cut(s) 14
BsaBI GATNNNNATC 1 cut(s) 144
BsaHI GRCGYC 1 cut(s) 559
BsaWI WCCGGW 2 cut(s) 214, 291
Bsc4I CCNNNNNNNGG 2 cut(s) 245, 502
Bse118I RCCGGY 2 cut(s) 461, 600
Bse1I ACTGG 2 cut(s) 515, 623
Bse3DI GCAATG 1 cut(s) 690
Bse8I GATNNNNATC 1 cut(s) 144
BseAI TCCGGA 1 cut(s) 214
BseBI CCWGG 1 cut(s) 574
BseGI GGATG 3 cut(s) 394, 730, 750
BseJI GATNNNNATC 1 cut(s) 144
BseLI CCNNNNNNNGG 2 cut(s) 245, 502
BseMI GCAATG 1 cut(s) 690
BseMII CTCAG 1 cut(s) 336
BseNI ACTGG 2 cut(s) 515, 623
BseRI GAGGAG 1 cut(s) 176
BseXI GCAGC 2 cut(s) 142, 368
BshFI GGCC 2 cut(s) 514, 622
BsiSI CCGG 4 cut(s) 215, 292, 462, 601
BslFI GGGAC 2 cut(s) 546, 570
BslI CCNNNNNNNGG 2 cut(s) 245, 502
BsmAI GTCTC 2 cut(s) 83, 336
BsmBI CGTCTC 2 cut(s) 83, 336
BsmFI GGGAC 2 cut(s) 546, 570
BsnI GGCC 2 cut(s) 514, 622
Bsp1286I GDGCHC 2 cut(s) 275, 509
Bsp13I TCCGGA 1 cut(s) 214
Bsp143I GATC 5 cut(s) 73, 391, 586, 727, 791
BspACI CCGC 2 cut(s) 103, 539
BspANI GGCC 2 cut(s) 514, 622
BspCNI CTCAG 1 cut(s) 337
BspEI TCCGGA 1 cut(s) 214
BspMAI CTGCAG 1 cut(s) 358
BspPI GGATC 1 cut(s) 722
BsrDI GCAATG 1 cut(s) 690
BsrFI RCCGGY 2 cut(s) 461, 600
BsrI ACTGG 2 cut(s) 515, 623
BssAI RCCGGY 2 cut(s) 461, 600
BssMI GATC 5 cut(s) 73, 391, 586, 727, 791
BssNI GRCGYC 1 cut(s) 559
Bst2UI CCWGG 1 cut(s) 574
BstACI GRCGYC 1 cut(s) 559
BstC8I GCNNGC 4 cut(s) 19, 579, 666, 697
BstDEI CTNAG 3 cut(s) 345, 483, 810
BstF5I GGATG 3 cut(s) 394, 730, 750
BstKTI GATC 5 cut(s) 76, 394, 589, 730, 794
BstMAI GTCTC 2 cut(s) 83, 336
BstMBI GATC 5 cut(s) 73, 391, 586, 727, 791
BstMWI GCNNNNNNNGC 4 cut(s) 208, 526, 578, 775
BstNI CCWGG 1 cut(s) 574
BstNSI RCATGY 2 cut(s) 103, 546
BstSCI CCNGG 1 cut(s) 572
BstSFI CTRYAG 1 cut(s) 354
BstV1I GCAGC 2 cut(s) 142, 368
BstX2I RGATCY 1 cut(s) 791
BstYI RGATCY 1 cut(s) 791
BsuRI GGCC 2 cut(s) 514, 622
BtsCI GGATG 3 cut(s) 394, 730, 750
BtsI GCAGTG 1 cut(s) 186
BtsIMutI CAGTG 3 cut(s) 186, 522, 616
Cac8I GCNNGC 4 cut(s) 19, 579, 666, 697
Cfr10I RCCGGY 2 cut(s) 461, 600
Cfr13I GGNCC 3 cut(s) 121, 367, 687
Csp6I GTAC 2 cut(s) 628, 652
CviAII CATG 6 cut(s) 83, 100, 443, 543, 684, 801
CviQI GTAC 2 cut(s) 628, 652
DdeI CTNAG 3 cut(s) 345, 483, 810
DpnI GATC 5 cut(s) 75, 393, 588, 729, 793
DpnII GATC 5 cut(s) 73, 391, 586, 727, 791
DraIII CACNNNGTG 1 cut(s) 486
DriI GACNNNNNGTC 1 cut(s) 558
EaeI YGGCCR 2 cut(s) 512, 620
Eam1105I GACNNNNNGTC 1 cut(s) 558
Eco24I GRGCYC 2 cut(s) 275, 509
Eco32I GATATC 1 cut(s) 750
Eco47I GGWCC 3 cut(s) 121, 367, 687
Eco57I CTGAAG 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 572
EcoRV GATATC 1 cut(s) 750
EcoT38I GRGCYC 2 cut(s) 275, 509
Esp3I CGTCTC 2 cut(s) 83, 336
FaeI CATG 6 cut(s) 86, 103, 446, 546, 687, 804
FalI AAGNNNNNCTT 2 cut(s) 781, 813
FaqI GGGAC 2 cut(s) 546, 570
FatI CATG 6 cut(s) 82, 99, 442, 542, 683, 800
Fnu4HI GCNGC 3 cut(s) 131, 357, 540
FokI GGATG 3 cut(s) 401, 737, 757
FriOI GRGCYC 2 cut(s) 275, 509
Fsp4HI GCNGC 3 cut(s) 131, 357, 540
FspBI CTAG 1 cut(s) 755
GluI GCNGC 3 cut(s) 131, 357, 540
HaeIII GGCC 2 cut(s) 514, 622
HapII CCGG 4 cut(s) 215, 292, 462, 601
Hin1I GRCGYC 1 cut(s) 559
Hin1II CATG 6 cut(s) 86, 103, 446, 546, 687, 804
HincII GTYRAC 1 cut(s) 534
HindII GTYRAC 1 cut(s) 534
HinfI GANTC 3 cut(s) 206, 241, 322
HpaII CCGG 4 cut(s) 215, 292, 462, 601
HphI GGTGA 1 cut(s) 451
Hpy166II GTNNAC 2 cut(s) 184, 534
Hpy188I TCNGA 4 cut(s) 263, 401, 429, 591
Hpy188III TCNNGA 1 cut(s) 215
Hpy8I GTNNAC 2 cut(s) 184, 534
HpyAV CCTTC 1 cut(s) 741
HpyCH4IV ACGT 2 cut(s) 382, 559
HpyCH4V TGCA 2 cut(s) 356, 695
HpyF10VI GCNNNNNNNGC 4 cut(s) 208, 526, 578, 775
HpyF3I CTNAG 3 cut(s) 345, 483, 810
HpySE526I ACGT 2 cut(s) 382, 559
Hsp92I GRCGYC 1 cut(s) 559
Hsp92II CATG 6 cut(s) 86, 103, 446, 546, 687, 804
Kpn2I TCCGGA 1 cut(s) 214
Kzo9I GATC 5 cut(s) 73, 391, 586, 727, 791
LmnI GCTCC 1 cut(s) 105
Lsp1109I GCAGC 2 cut(s) 142, 368
MaeI CTAG 1 cut(s) 755
MaeII ACGT 2 cut(s) 382, 559
MaeIII GTNAC 3 cut(s) 457, 467, 491
MalI GATC 5 cut(s) 75, 393, 588, 729, 793
MboI GATC 5 cut(s) 73, 391, 586, 727, 791
MboII GAAGA 3 cut(s) 389, 724, 773
MflI RGATCY 1 cut(s) 791
MhlI GDGCHC 2 cut(s) 275, 509
MlsI TGGCCA 2 cut(s) 514, 622
MluCI AATT 5 cut(s) 53, 310, 417, 453, 567
MluNI TGGCCA 2 cut(s) 514, 622
MlyI GAGTC 1 cut(s) 250
MmeI TCCRAC 3 cut(s) 379, 452, 702
MnlI CCTC 4 cut(s) 57, 154, 642, 751
Mox20I TGGCCA 2 cut(s) 514, 622
MroI TCCGGA 1 cut(s) 214
MroXI GAANNNNTTC 1 cut(s) 188
MscI TGGCCA 2 cut(s) 514, 622
MslI CAYNNNNRTG 1 cut(s) 179
Msp20I TGGCCA 2 cut(s) 514, 622
MspA1I CMGCKG 1 cut(s) 539
MspI CCGG 4 cut(s) 215, 292, 462, 601
MspR9I CCNGG 1 cut(s) 574
MvaI CCWGG 1 cut(s) 574
MwoI GCNNNNNNNGC 4 cut(s) 208, 526, 578, 775
NdeII GATC 5 cut(s) 73, 391, 586, 727, 791
NlaIII CATG 6 cut(s) 86, 103, 446, 546, 687, 804
NmuCI GTSAC 2 cut(s) 457, 467
NspI RCATGY 2 cut(s) 103, 546
OliI CACNNNNGTG 1 cut(s) 179
PdmI GAANNNNTTC 1 cut(s) 188
PfeI GAWTC 2 cut(s) 206, 322
PkrI GCNGC 3 cut(s) 132, 358, 541
PleI GAGTC 1 cut(s) 249
PpsI GAGTC 1 cut(s) 249
PsiI TTATAA 1 cut(s) 785
Psp1406I AACGTT 1 cut(s) 382
Psp6I CCWGG 1 cut(s) 572
PspGI CCWGG 1 cut(s) 572
PspPI GGNCC 3 cut(s) 121, 367, 687
PstI CTGCAG 1 cut(s) 358
PsuI RGATCY 1 cut(s) 791
RsaI GTAC 2 cut(s) 629, 653
RsaNI GTAC 2 cut(s) 628, 652
RseI CAYNNNNRTG 1 cut(s) 179
SatI GCNGC 3 cut(s) 131, 357, 540
Sau3AI GATC 5 cut(s) 73, 391, 586, 727, 791
Sau96I GGNCC 3 cut(s) 121, 367, 687
ScaI AGTACT 1 cut(s) 629
SchI GAGTC 1 cut(s) 250
ScrFI CCNGG 1 cut(s) 574
SduI GDGCHC 2 cut(s) 275, 509
SetI ASST 8 cut(s) 95, 110, 126, 135, 372, 385, 562, 653
SfcI CTRYAG 1 cut(s) 354
SinI GGWCC 3 cut(s) 121, 367, 687
SmiMI CAYNNNNRTG 1 cut(s) 179
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 5 cut(s) 53, 310, 417, 453, 567
SsiI CCGC 2 cut(s) 103, 539
SspMI CTAG 1 cut(s) 755
StyD4I CCNGG 1 cut(s) 572
TaiI ACGT 2 cut(s) 385, 562
TaqI TCGA 2 cut(s) 228, 608
TasI AATT 5 cut(s) 53, 310, 417, 453, 567
TatI WGTACW 1 cut(s) 627
TauI GCSGC 1 cut(s) 542
TfiI GAWTC 2 cut(s) 206, 322
TscAI CASTG 3 cut(s) 186, 522, 623
TseFI GTSAC 2 cut(s) 457, 467
TseI GCWGC 2 cut(s) 130, 356
Tsp45I GTSAC 2 cut(s) 457, 467
TspDTI ATGAA 4 cut(s) 223, 247, 788, 789
TspGWI ACGGA 1 cut(s) 685
TspRI CASTG 3 cut(s) 186, 522, 623
VpaK11BI GGWCC 3 cut(s) 121, 367, 687
XapI RAATTY 2 cut(s) 53, 417
XceI RCATGY 2 cut(s) 103, 546
XcmI CCANNNNNNNNNTGG 1 cut(s) 522
XmnI GAANNNNTTC 1 cut(s) 188
XspI CTAG 1 cut(s) 755
ZraI GACGTC 1 cut(s) 560
ZrmI AGTACT 1 cut(s) 629
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.