Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000468.1

Orthogroup ID

OG0009613

Physical Location & Seq

Genomic Coordinates Reverse (-)

31129 .. 34711

Gene Structure 3583 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000468.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1326 bp

atgggggagtgggtcattggggctttcatcaacctttttggcagcattgccatcaactttggaactaaccttcttaaattggggcataatgagagagagaggcattcaatgctagaaggtgatggaacaaatggaaagcttcctttgaaacctattatatacttccagacatggagagttggctttttattttttgttcttggaaattgcctaaattttatatccttcggatatgctgctcagtcacttctggcggcactgggatctattcaatttatatccaacattgcatttgcttactttgtcttaaacaaaatggtgactgtcaaggtaatggttgccacgacctttatcgttcttgggaacatttttcttgttgcttttggcaaccaccagtctcctgtgttcacaccagagcagctagctgagaaatttagcaacattacattccttctttactgtctgattttgattttgattgttgcagtacatcactccatttacaggagaggagtacttctccatgcagtttgtggacatgatctgagatcgtattggcacatgctgcttcctttttcctatgccatagtttcaggtgctgtagggtcattctcagtgttgtttgcaaaatctctctctaatctgctacggttggtgatgtctagcagttatcagttacatagctggttcacatattccatgctccttctatttctaagtacagctggattttggatggctaggttgaatgaaggattgtcactgttcgatgcaattcttattgttcctatgttccagattgcttggacattcttttccatttgtacaggatttgtatattttcaagagtaccaggtattaaatgcactaaggacgacgatgttcattctcggaatgatgtctgtgttcgcaggcatatctttgctggcacctgatgaatccaaaggtggtgacgtcaaagataattcatctttagtttctgtaagcattccaaaagaagtggacaggattgttgtgccatctgaggatatacaaaccagggatacaagatcatttgtgcaaggaatcctgatgaagatttcagatgcactagtgaaggcaaagactgcttgtgcattatctttaggatttggagaggattcaatcaatgcatctgcagtgcttgtgatgccgatggtgtcatcaaagataacaggctttagaggaaatggatttgaccgtgccaagattttctccatgagaaattccggttggaccaagatctctatggatgaagatgctacaaaaatgctagagacaagccctatgctctctgaaagcccgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005769 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0008150 GO:0012505 GO:0015693 GO:0016020 GO:0030001 GO:0031410 GO:0031982 GO:0043226 GO:0043227 GO:0043229 GO:0044424 GO:0044444 GO:0044464 GO:0051179 GO:0051234 GO:0070838 GO:0071944 GO:0072511 GO:0097708

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Mg_trans_NIPA

Protein Analysis

441

Amino Acids

48.9

Weight (kDa)

8.5

Isoelectric Point (pI)

33.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009613)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G26670 AT3G26670 AT3G26670 AT3G26670
fragaria_vesca	FvH4_6g54450
malus_domestica	MD09G1001000.v1.1 MD17G1004100.v1.1
prunus_persica	Prupe.3G315100_v2.0.a1 Prupe.3G315100_v2.0.a1 Prupe.3G315100_v2.0.a1 Prupe.3G315100_v2.0.a1
pyrus_communis	pycom17g00080
rosa_chinensis	RchiOBHm_Chr2g0176711
rosa_laevigata	RLG00000022438
rosa_multiflora	Rmu_ssc0000468.1_g000006
rosa_roxburghii	Rroxscaffold_2G00076230
rosa_rugosa	Rorug02G0597800 Rorug02G0598000
rosa_samantha	Rh2AG675200 Rh2BG686400 Rh2DG700500
rosa_wichuraiana	Rw2G055420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	957
AccB1I	GGYRCC	1 cut(s)	928
AciI	CCGC	1 cut(s)	254
AclWI	GGATC	1 cut(s)	271
AcsI	RAATTY	3 cut(s)	214, 431, 1243
AcyI	GRCGYC	1 cut(s)	954
AfaI	GTAC	5 cut(s)	489, 516, 721, 826, 851
AfiI	CCNNNNNNNGG	1 cut(s)	504
AgsI	TTSAA	6 cut(s)	108, 148, 272, 748, 845, 1143
AhlI	ACTAGT	1 cut(s)	1090
AjnI	CCWGG	2 cut(s)	852, 1037
AjuI	GAANNNNNNNTTGG	2 cut(s)	1234, 1266
AluBI	AGCT	5 cut(s)	139, 421, 425, 684, 725
AluI	AGCT	5 cut(s)	139, 421, 425, 684, 725
Alw26I	GTCTC	2 cut(s)	402, 1289
AlwI	GGATC	1 cut(s)	271
AlwNI	CAGNNNCTG	1 cut(s)	599
ApeKI	GCWGC	4 cut(s)	42, 236, 418, 565
ApoI	RAATTY	3 cut(s)	214, 431, 1243
AspS9I	GGNCC	1 cut(s)	1254
AsuHPI	GGTGA	4 cut(s)	131, 331, 667, 962
AsuNHI	GCTAGC	1 cut(s)	421
AvaII	GGWCC	1 cut(s)	1254
BanI	GGYRCC	1 cut(s)	928
BbvI	GCAGC	4 cut(s)	54, 223, 430, 552
BccI	CCATC	5 cut(s)	59, 116, 730, 1027, 1168
BciT130I	CCWGG	2 cut(s)	854, 1039
BciVI	GTATCC	1 cut(s)	1036
BcoDI	GTCTC	2 cut(s)	402, 1289
BcuI	ACTAGT	1 cut(s)	1090
BfaI	CTAG	6 cut(s)	113, 422, 663, 741, 1091, 1292
BfmI	CTRYAG	2 cut(s)	600, 1155
BfuI	GTATCC	1 cut(s)	1036
BglII	AGATCT	1 cut(s)	1260
BisI	GCNGC	5 cut(s)	43, 237, 255, 419, 566
BlsI	GCNGC	5 cut(s)	44, 238, 256, 420, 567
BmcAI	AGTACT	1 cut(s)	516
Bme1390I	CCNGG	2 cut(s)	854, 1039
Bme18I	GGWCC	1 cut(s)	1254
BmgT120I	GGNCC	1 cut(s)	1254
BmiI	GGNNCC	1 cut(s)	930
BmrFI	CCNGG	2 cut(s)	854, 1039
BmrI	ACTGGG	1 cut(s)	269
BmsI	GCATC	5 cut(s)	760, 1075, 1158, 1160, 1267
BmtI	GCTAGC	1 cut(s)	425
BmuI	ACTGGG	1 cut(s)	269
BplI	GAGNNNNNCTC	2 cut(s)	504, 536
BsaHI	GRCGYC	1 cut(s)	954
BsaJI	CCNNGG	1 cut(s)	1038
BsaWI	WCCGGW	1 cut(s)	1247
Bsc4I	CCNNNNNNNGG	1 cut(s)	504
Bse1I	ACTGG	2 cut(s)	264, 394
Bse3DI	GCAATG	2 cut(s)	45, 285
BseBI	CCWGG	2 cut(s)	854, 1039
BseDI	CCNNGG	1 cut(s)	1038
BseGI	GGATG	2 cut(s)	741, 1276
BseLI	CCNNNNNNNGG	1 cut(s)	504
BseMI	GCAATG	2 cut(s)	45, 285
BseMII	CTCAG	5 cut(s)	254, 417, 536, 627, 1014
BseNI	ACTGG	2 cut(s)	264, 394
BseRI	GAGGAG	1 cut(s)	525
BseXI	GCAGC	4 cut(s)	54, 223, 430, 552
BshNI	GGYRCC	1 cut(s)	928
BsiSI	CCGG	1 cut(s)	1248
BslI	CCNNNNNNNGG	1 cut(s)	504
BsmAI	GTCTC	2 cut(s)	402, 1289
BsmI	GAATGC	2 cut(s)	103, 987
Bsp1407I	TGTACA	1 cut(s)	824
Bsp143I	GATC	5 cut(s)	263, 541, 548, 1049, 1260
BspACI	CCGC	1 cut(s)	254
BspCNI	CTCAG	5 cut(s)	253, 418, 537, 626, 1015
BspLI	GGNNCC	1 cut(s)	930
BspMAI	CTGCAG	1 cut(s)	1159
BspOI	GCTAGC	1 cut(s)	425
BspPI	GGATC	1 cut(s)	271
BspT107I	GGYRCC	1 cut(s)	928
BsrDI	GCAATG	2 cut(s)	45, 285
BsrGI	TGTACA	1 cut(s)	824
BsrI	ACTGG	2 cut(s)	264, 394
BssECI	CCNNGG	1 cut(s)	1038
BssMI	GATC	5 cut(s)	263, 541, 548, 1049, 1260
BssNI	GRCGYC	1 cut(s)	954
Bst2UI	CCWGG	2 cut(s)	854, 1039
Bst4CI	ACNGT	5 cut(s)	325, 461, 651, 765, 1220
BstACI	GRCGYC	1 cut(s)	954
BstAPI	GCANNNNNTGC	3 cut(s)	109, 565, 1106
BstAUI	TGTACA	1 cut(s)	824
BstC8I	GCNNGC	3 cut(s)	423, 913, 927
BstDEI	CTNAG	7 cut(s)	240, 426, 545, 613, 716, 869, 1023
BstF5I	GGATG	2 cut(s)	741, 1276
BstKTI	GATC	5 cut(s)	266, 544, 551, 1052, 1263
BstMAI	GTCTC	2 cut(s)	402, 1289
BstMBI	GATC	5 cut(s)	263, 541, 548, 1049, 1260
BstMWI	GCNNNNNNNGC	4 cut(s)	109, 565, 1106, 1168
BstNI	CCWGG	2 cut(s)	854, 1039
BstNSI	RCATGY	1 cut(s)	565
BstSCI	CCNGG	2 cut(s)	852, 1037
BstSFI	CTRYAG	2 cut(s)	600, 1155
BstV1I	GCAGC	4 cut(s)	54, 223, 430, 552
BstX2I	RGATCY	2 cut(s)	263, 1260
BstYI	RGATCY	2 cut(s)	263, 1260
BsuI	GTATCC	1 cut(s)	1036
BtsCI	GGATG	2 cut(s)	741, 1276
BtsI	GCAGTG	1 cut(s)	1164
BtsIMutI	CAGTG	4 cut(s)	257, 621, 761, 1164
Cac8I	GCNNGC	3 cut(s)	423, 913, 927
CaiI	CAGNNNCTG	1 cut(s)	599
Cfr13I	GGNCC	1 cut(s)	1254
CsiI	ACCWGGT	1 cut(s)	852
Csp6I	GTAC	5 cut(s)	488, 515, 720, 825, 850
CspCI	CAANNNNNGTGG	2 cut(s)	981, 1016
CviAII	CATG	6 cut(s)	171, 524, 539, 562, 700, 1237
CviQI	GTAC	5 cut(s)	488, 515, 720, 825, 850
DdeI	CTNAG	7 cut(s)	240, 426, 545, 613, 716, 869, 1023
DpnI	GATC	5 cut(s)	265, 543, 550, 1051, 1262
DpnII	GATC	5 cut(s)	263, 541, 548, 1049, 1260
Eco47I	GGWCC	1 cut(s)	1254
EcoRII	CCWGG	2 cut(s)	852, 1037
EcoT22I	ATGCAT	1 cut(s)	1153
FaeI	CATG	6 cut(s)	174, 527, 542, 565, 703, 1240
FatI	CATG	6 cut(s)	170, 523, 538, 561, 699, 1236
Fnu4HI	GCNGC	5 cut(s)	43, 237, 255, 419, 566
FokI	GGATG	2 cut(s)	748, 1283
Fsp4HI	GCNGC	5 cut(s)	43, 237, 255, 419, 566
FspBI	CTAG	6 cut(s)	113, 422, 663, 741, 1091, 1292
GluI	GCNGC	5 cut(s)	43, 237, 255, 419, 566
HapII	CCGG	1 cut(s)	1248
Hin1I	GRCGYC	1 cut(s)	954
Hin1II	CATG	6 cut(s)	174, 527, 542, 565, 703, 1240
HindIII	AAGCTT	1 cut(s)	137
HinfI	GANTC	3 cut(s)	938, 1065, 1139
HpaII	CCGG	1 cut(s)	1248
HphI	GGTGA	4 cut(s)	131, 331, 667, 962
Hpy166II	GTNNAC	4 cut(s)	408, 536, 690, 1003
Hpy188I	TCNGA	7 cut(s)	230, 465, 546, 893, 1024, 1084, 1315
Hpy188III	TCNNGA	4 cut(s)	166, 796, 845, 1069
Hpy8I	GTNNAC	4 cut(s)	408, 536, 690, 1003
Hpy99I	CGWCG	1 cut(s)	880
HpyAV	CCTTC	7 cut(s)	80, 110, 235, 461, 716, 746, 1090
HpyCH4III	ACNGT	5 cut(s)	325, 461, 651, 765, 1220
HpyCH4IV	ACGT	1 cut(s)	954
HpyF10VI	GCNNNNNNNGC	4 cut(s)	109, 565, 1106, 1168
HpyF3I	CTNAG	7 cut(s)	240, 426, 545, 613, 716, 869, 1023
HpySE526I	ACGT	1 cut(s)	954
Hsp92I	GRCGYC	1 cut(s)	954
Hsp92II	CATG	6 cut(s)	174, 527, 542, 565, 703, 1240
Kzo9I	GATC	5 cut(s)	263, 541, 548, 1049, 1260
LmnI	GCTCC	1 cut(s)	708
Lsp1109I	GCAGC	4 cut(s)	54, 223, 430, 552
LweI	GCATC	5 cut(s)	760, 1075, 1158, 1160, 1267
MabI	ACCWGGT	1 cut(s)	852
MaeI	CTAG	6 cut(s)	113, 422, 663, 741, 1091, 1292
MaeII	ACGT	1 cut(s)	954
MaeIII	GTNAC	5 cut(s)	243, 319, 675, 759, 950
MalI	GATC	5 cut(s)	265, 543, 550, 1051, 1262
MboI	GATC	5 cut(s)	263, 541, 548, 1049, 1260
MboII	GAAGA	2 cut(s)	1087, 1286
MflI	RGATCY	2 cut(s)	263, 1260
MluCI	AATT	8 cut(s)	77, 205, 214, 272, 431, 774, 964, 1243
MmeI	TCCRAC	2 cut(s)	306, 1232
MnlI	CCTC	5 cut(s)	93, 503, 1018, 1129, 1196
Mph1103I	ATGCAT	1 cut(s)	1153
MseI	TTAA	3 cut(s)	75, 308, 860
MspA1I	CMGCKG	1 cut(s)	725
MspI	CCGG	1 cut(s)	1248
MspR9I	CCNGG	2 cut(s)	854, 1039
Mva1269I	GAATGC	2 cut(s)	103, 987
MvaI	CCWGG	2 cut(s)	854, 1039
MwoI	GCNNNNNNNGC	4 cut(s)	109, 565, 1106, 1168
NdeII	GATC	5 cut(s)	263, 541, 548, 1049, 1260
NheI	GCTAGC	1 cut(s)	421
NlaIII	CATG	6 cut(s)	174, 527, 542, 565, 703, 1240
NlaIV	GGNNCC	1 cut(s)	930
NmuCI	GTSAC	4 cut(s)	243, 319, 759, 950
NsiI	ATGCAT	1 cut(s)	1153
NspI	RCATGY	1 cut(s)	565
PctI	GAATGC	2 cut(s)	103, 987
PfeI	GAWTC	3 cut(s)	938, 1065, 1139
PkrI	GCNGC	5 cut(s)	44, 238, 256, 420, 567
Psp6I	CCWGG	2 cut(s)	852, 1037
PspGI	CCWGG	2 cut(s)	852, 1037
PspN4I	GGNNCC	1 cut(s)	930
PspPI	GGNCC	1 cut(s)	1254
PstI	CTGCAG	1 cut(s)	1159
PstNI	CAGNNNCTG	1 cut(s)	599
PsuI	RGATCY	2 cut(s)	263, 1260
PvuII	CAGCTG	1 cut(s)	725
RsaI	GTAC	5 cut(s)	489, 516, 721, 826, 851
RsaNI	GTAC	5 cut(s)	488, 515, 720, 825, 850
SaqAI	TTAA	3 cut(s)	75, 308, 860
SatI	GCNGC	5 cut(s)	43, 237, 255, 419, 566
Sau3AI	GATC	5 cut(s)	263, 541, 548, 1049, 1260
Sau96I	GGNCC	1 cut(s)	1254
ScaI	AGTACT	1 cut(s)	516
ScrFI	CCNGG	2 cut(s)	854, 1039
SexAI	ACCWGGT	1 cut(s)	852
SfaNI	GCATC	5 cut(s)	760, 1075, 1158, 1160, 1267
SfcI	CTRYAG	2 cut(s)	600, 1155
SinI	GGWCC	1 cut(s)	1254
SpeI	ACTAGT	1 cut(s)	1090
Sse9I	AATT	8 cut(s)	77, 205, 214, 272, 431, 774, 964, 1243
SsiI	CCGC	1 cut(s)	254
SspMI	CTAG	6 cut(s)	113, 422, 663, 741, 1091, 1292
StyD4I	CCNGG	2 cut(s)	852, 1037
TaaI	ACNGT	5 cut(s)	325, 461, 651, 765, 1220
TaiI	ACGT	1 cut(s)	957
TaqI	TCGA	1 cut(s)	768
TasI	AATT	8 cut(s)	77, 205, 214, 272, 431, 774, 964, 1243
TatI	WGTACW	4 cut(s)	487, 514, 719, 824
TauI	GCSGC	1 cut(s)	257
TfiI	GAWTC	3 cut(s)	938, 1065, 1139
Tru1I	TTAA	3 cut(s)	75, 308, 860
Tru9I	TTAA	3 cut(s)	75, 308, 860
TscAI	CASTG	4 cut(s)	264, 621, 768, 1164
TseFI	GTSAC	4 cut(s)	243, 319, 759, 950
TseI	GCWGC	4 cut(s)	42, 236, 418, 565
Tsp45I	GTSAC	4 cut(s)	243, 319, 759, 950
TspDTI	ATGAA	7 cut(s)	16, 765, 874, 951, 957, 1088, 1287
TspRI	CASTG	4 cut(s)	264, 621, 768, 1164
VpaK11BI	GGWCC	1 cut(s)	1254
XapI	RAATTY	3 cut(s)	214, 431, 1243
XceI	RCATGY	1 cut(s)	565
XcmI	CCANNNNNNNNNTGG	2 cut(s)	530, 1264
XspI	CTAG	6 cut(s)	113, 422, 663, 741, 1091, 1292
ZraI	GACGTC	1 cut(s)	955
ZrmI	AGTACT	1 cut(s)	516
Zsp2I	ATGCAT	1 cut(s)	1153

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.