Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000486.1

Orthogroup ID

OG0008691

Physical Location & Seq

Genomic Coordinates Forward (+)

95471 .. 96964

Gene Structure 1494 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000486.1_g000028.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1062 bp

atgcagatagtagtcaatgctggtaatggatcaggaggcttcttcacatgggatgtgttagacaaactaggagcagacacatttgggtctctacacctcaaaccagatgggatgtttccaaaccacattcccaacccagaggacaaagtcgccatggcacttacaagggctgcagtgctagaaaactctgctgatcttggaattgtgttcgacactgatgtggaccgcagtggcgttgtagataacaaaggcaatcccattaatggggacaagcttattgctttgatttcagctattgtattgaaggaccaccctggaaccaccattgtgactgatgctcgaacaagtatggcacttacaagattcatcaccaacagaggaggtcaccattgtttatatcgcgttggttacaggaatgtgattgacaagggagtccagcttaataaggatggcattgaaactcatcttatgatggaaacttcaggacatggtgctcttaaagagaactttttccttgatgatggggcttacatggtggtgaagatcatcattgagatggtacgaatgaagcttgctgggtcagatgaagttattggaagtatcattaacgatcttgaagaaccaaaagattctgtagagctaaggatgaatgtagtctctgaccctagatatgcaaaagaaaaggcaatcgaggcaattgaaacgtttcgacagtacgtggaggagggaagaattgaaggatgggaattagatacatgtggagattgttgggtcagcgaaggctgtctagcagacacaaatgaaaccttggctgctgcagttgacgctcacatgtatagggcaaaagtatcagatgaggtgcgtggacaacatggttgggtacacattcggcagagcattcacaacccgaatattgcagtgaacatgcaatcatctgtgcctggctgttgccaaatgatgacgatagttcttcgagataaatttctcatagctggtgaaatggacagaatccttgacattactgagattgacaagtacgccaaaagtggaattgtaggctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004615 GO:0005975 GO:0008150 GO:0008152 GO:0016853 GO:0016866 GO:0016868 GO:0044238 GO:0071704

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PGM_PMM_I PGM_PMM_II PGM_PMM_III

Protein Analysis

353

Amino Acids

38.81

Weight (kDa)

5.05

Isoelectric Point (pI)

23.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008691)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G70820 AT1G70820
fragaria_vesca	FvH4_4g32820
malus_domestica	MD16G1023700.v1.1
prunus_persica	Prupe.1G329200_v2.0.a1 Prupe.1G329200_v2.0.a1 Prupe.1G329200_v2.0.a1 Prupe.1G329200_v2.0.a1
pyrus_communis	pycom16g02060
rosa_chinensis	RchiOBHm_Chr4g0441801
rosa_laevigata	RLG00000006065
rosa_multiflora	Rmu_co8034156.1_g000001 Rmu_co8340765.1_g000001 Rmu_sc0013960.1_g000003 Rmu_ssc0000486.1_g000028
rosa_roxburghii	Rroxscaffold_5G00382620
rosa_rugosa	Rorug04G0336300 Rorug04G0336400
rosa_samantha	Rh4AG387800 Rh4BG401500 Rh4CG416500 Rh4DG394800
rosa_wichuraiana	Rw4G033470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	431
AccII	CGCG	1 cut(s)	402
AciI	CCGC	1 cut(s)	226
AclI	AACGTT	1 cut(s)	704
AclWI	GGATC	1 cut(s)	37
AcsI	RAATTY	1 cut(s)	980
AcuI	CTGAAG	1 cut(s)	465
AfaI	GTAC	4 cut(s)	561, 716, 882, 1037
AfiI	CCNNNNNNNGG	2 cut(s)	263, 264
AflIII	ACRYGT	2 cut(s)	755, 831
AgsI	TTSAA	5 cut(s)	304, 458, 617, 701, 737
AjnI	CCWGG	2 cut(s)	313, 940
AleI	CACNNNNGTG	2 cut(s)	218, 326
AluBI	AGCT	6 cut(s)	274, 293, 439, 571, 640, 992
AluI	AGCT	6 cut(s)	274, 293, 439, 571, 640, 992
Alw21I	GWGCWC	1 cut(s)	496
Alw26I	GTCTC	2 cut(s)	93, 661
AlwI	GGATC	1 cut(s)	37
ApeKI	GCWGC	3 cut(s)	170, 812, 815
ApoI	RAATTY	1 cut(s)	980
AseI	ATTAAT	1 cut(s)	261
Asp700I	GAANNNNTTC	2 cut(s)	509, 705
AspS9I	GGNCC	2 cut(s)	223, 307
AsuHPI	GGTGA	4 cut(s)	361, 377, 550, 1007
AvaII	GGWCC	2 cut(s)	223, 307
Bbv12I	GWGCWC	1 cut(s)	496
BbvI	GCAGC	3 cut(s)	157, 799, 802
BccI	CCATC	6 cut(s)	101, 443, 466, 515, 550, 735
BciT130I	CCWGG	2 cut(s)	315, 942
BcoDI	GTCTC	2 cut(s)	93, 661
BfaI	CTAG	4 cut(s)	68, 179, 666, 788
BfmI	CTRYAG	3 cut(s)	171, 633, 816
BisI	GCNGC	3 cut(s)	171, 813, 816
BlsI	GCNGC	3 cut(s)	172, 814, 817
Bme1390I	CCNGG	2 cut(s)	315, 942
Bme18I	GGWCC	2 cut(s)	223, 307
BmgT120I	GGNCC	2 cut(s)	223, 307
BmiI	GGNNCC	1 cut(s)	319
BmrFI	CCNGG	2 cut(s)	315, 942
BmsI	GCATC	1 cut(s)	325
Bpu10I	CCTNAGC	1 cut(s)	641
BsaAI	YACGTR	1 cut(s)	718
BsaI	GGTCTC	1 cut(s)	93
BsaJI	CCNNGG	3 cut(s)	153, 313, 807
Bsc4I	CCNNNNNNNGG	2 cut(s)	263, 264
BseBI	CCWGG	2 cut(s)	315, 942
BseDI	CCNNGG	3 cut(s)	153, 313, 807
BseGI	GGATG	5 cut(s)	58, 117, 454, 651, 746
BseLI	CCNNNNNNNGG	2 cut(s)	263, 264
BseMII	CTCAG	1 cut(s)	1014
BseRI	GAGGAG	2 cut(s)	393, 737
BseXI	GCAGC	3 cut(s)	157, 799, 802
BseYI	CCCAGC	1 cut(s)	575
Bsh1236I	CGCG	1 cut(s)	402
BsiHKAI	GWGCWC	1 cut(s)	496
BslFI	GGGAC	1 cut(s)	281
BslI	CCNNNNNNNGG	2 cut(s)	263, 264
BsmAI	GTCTC	2 cut(s)	93, 661
BsmFI	GGGAC	1 cut(s)	281
BsmI	GAATGC	1 cut(s)	897
Bso31I	GGTCTC	1 cut(s)	93
Bsp1286I	GDGCHC	1 cut(s)	496
Bsp143I	GATC	4 cut(s)	29, 193, 543, 610
Bsp19I	CCATGG	1 cut(s)	153
BspACI	CCGC	1 cut(s)	226
BspCNI	CTCAG	1 cut(s)	1015
BspFNI	CGCG	1 cut(s)	402
BspLI	GGNNCC	1 cut(s)	319
BspMAI	CTGCAG	2 cut(s)	175, 820
BspPI	GGATC	1 cut(s)	37
BspTNI	GGTCTC	1 cut(s)	93
BssECI	CCNNGG	3 cut(s)	153, 313, 807
BssMI	GATC	4 cut(s)	29, 193, 543, 610
BssT1I	CCWWGG	2 cut(s)	153, 807
Bst2UI	CCWGG	2 cut(s)	315, 942
Bst4CI	ACNGT	1 cut(s)	714
BstBAI	YACGTR	1 cut(s)	718
BstC8I	GCNNGC	1 cut(s)	573
BstDEI	CTNAG	2 cut(s)	641, 1023
BstDSI	CCRYGG	1 cut(s)	153
BstEII	GGTNACC	1 cut(s)	383
BstF5I	GGATG	5 cut(s)	58, 117, 454, 651, 746
BstFNI	CGCG	1 cut(s)	402
BstKTI	GATC	4 cut(s)	32, 196, 546, 613
BstMAI	GTCTC	2 cut(s)	93, 661
BstMBI	GATC	4 cut(s)	29, 193, 543, 610
BstMWI	GCNNNNNNNGC	2 cut(s)	692, 824
BstNI	CCWGG	2 cut(s)	315, 942
BstNSI	RCATGY	3 cut(s)	759, 835, 928
BstPI	GGTNACC	1 cut(s)	383
BstSCI	CCNGG	2 cut(s)	313, 940
BstSFI	CTRYAG	3 cut(s)	171, 633, 816
BstUI	CGCG	1 cut(s)	402
BstV1I	GCAGC	3 cut(s)	157, 799, 802
BtgI	CCRYGG	1 cut(s)	153
BtsCI	GGATG	5 cut(s)	58, 117, 454, 651, 746
BtsI	GCAGTG	3 cut(s)	180, 235, 924
BtsIMutI	CAGTG	4 cut(s)	180, 213, 235, 924
Cac8I	GCNNGC	1 cut(s)	573
Cfr13I	GGNCC	2 cut(s)	223, 307
CseI	GACGC	1 cut(s)	833
Csp6I	GTAC	4 cut(s)	560, 715, 881, 1036
CviAII	CATG	8 cut(s)	48, 154, 488, 532, 756, 832, 872, 925
CviQI	GTAC	4 cut(s)	560, 715, 881, 1036
DdeI	CTNAG	2 cut(s)	641, 1023
DpnI	GATC	4 cut(s)	31, 195, 545, 612
DpnII	GATC	4 cut(s)	29, 193, 543, 610
DrdI	GACNNNNNNGTC	1 cut(s)	431
DseDI	GACNNNNNNGTC	1 cut(s)	431
Eco130I	CCWWGG	2 cut(s)	153, 807
Eco31I	GGTCTC	1 cut(s)	93
Eco47I	GGWCC	2 cut(s)	223, 307
Eco57I	CTGAAG	1 cut(s)	465
Eco91I	GGTNACC	1 cut(s)	383
EcoO65I	GGTNACC	1 cut(s)	383
EcoRII	CCWGG	2 cut(s)	313, 940
EcoT14I	CCWWGG	2 cut(s)	153, 807
ErhI	CCWWGG	2 cut(s)	153, 807
FaeI	CATG	8 cut(s)	51, 157, 491, 535, 759, 835, 875, 928
FaqI	GGGAC	1 cut(s)	281
FatI	CATG	8 cut(s)	47, 153, 487, 531, 755, 831, 871, 924
Fnu4HI	GCNGC	3 cut(s)	171, 813, 816
FokI	GGATG	5 cut(s)	65, 124, 461, 658, 753
Fsp4HI	GCNGC	3 cut(s)	171, 813, 816
FspBI	CTAG	4 cut(s)	68, 179, 666, 788
GluI	GCNGC	3 cut(s)	171, 813, 816
GsaI	CCCAGC	1 cut(s)	579
HgaI	GACGC	1 cut(s)	833
Hin1II	CATG	8 cut(s)	51, 157, 491, 535, 759, 835, 875, 928
HincII	GTYRAC	1 cut(s)	823
HindII	GTYRAC	1 cut(s)	823
HindIII	AAGCTT	2 cut(s)	272, 569
HinfI	GANTC	4 cut(s)	363, 432, 629, 1008
HphI	GGTGA	4 cut(s)	361, 377, 550, 1007
Hpy166II	GTNNAC	5 cut(s)	223, 823, 866, 883, 922
Hpy188I	TCNGA	3 cut(s)	583, 661, 853
Hpy188III	TCNNGA	4 cut(s)	33, 483, 614, 974
Hpy8I	GTNNAC	5 cut(s)	223, 823, 866, 883, 922
HpyAV	CCTTC	3 cut(s)	298, 731, 773
HpyCH4III	ACNGT	1 cut(s)	714
HpyCH4IV	ACGT	2 cut(s)	704, 717
HpyCH4V	TGCA	6 cut(s)	4, 173, 674, 818, 917, 928
HpyF10VI	GCNNNNNNNGC	2 cut(s)	692, 824
HpyF3I	CTNAG	2 cut(s)	641, 1023
HpySE526I	ACGT	2 cut(s)	704, 717
Hsp92II	CATG	8 cut(s)	51, 157, 491, 535, 759, 835, 875, 928
Kzo9I	GATC	4 cut(s)	29, 193, 543, 610
LmnI	GCTCC	1 cut(s)	71
Lsp1109I	GCAGC	3 cut(s)	157, 799, 802
LweI	GCATC	1 cut(s)	325
MaeI	CTAG	4 cut(s)	68, 179, 666, 788
MaeII	ACGT	2 cut(s)	704, 717
MaeIII	GTNAC	3 cut(s)	328, 383, 407
MalI	GATC	4 cut(s)	31, 195, 545, 612
MboI	GATC	4 cut(s)	29, 193, 543, 610
MboII	GAAGA	5 cut(s)	34, 553, 629, 741, 962
MfeI	CAATTG	1 cut(s)	696
MhlI	GDGCHC	1 cut(s)	496
MluCI	AATT	6 cut(s)	201, 696, 732, 746, 980, 1050
MlyI	GAGTC	1 cut(s)	441
MnlI	CCTC	9 cut(s)	29, 107, 133, 371, 374, 685, 715, 718, 850
MroXI	GAANNNNTTC	2 cut(s)	509, 705
MseI	TTAA	4 cut(s)	261, 441, 498, 606
MslI	CAYNNNNRTG	4 cut(s)	218, 326, 536, 554
MspR9I	CCNGG	2 cut(s)	315, 942
MunI	CAATTG	1 cut(s)	696
Mva1269I	GAATGC	1 cut(s)	897
MvaI	CCWGG	2 cut(s)	315, 942
MvnI	CGCG	1 cut(s)	402
MwoI	GCNNNNNNNGC	2 cut(s)	692, 824
NcoI	CCATGG	1 cut(s)	153
NdeII	GATC	4 cut(s)	29, 193, 543, 610
NlaIII	CATG	8 cut(s)	51, 157, 491, 535, 759, 835, 875, 928
NlaIV	GGNNCC	1 cut(s)	319
NmuCI	GTSAC	2 cut(s)	328, 383
NspI	RCATGY	3 cut(s)	759, 835, 928
OliI	CACNNNNGTG	2 cut(s)	218, 326
PciI	ACATGT	2 cut(s)	755, 831
PctI	GAATGC	1 cut(s)	897
PdmI	GAANNNNTTC	2 cut(s)	509, 705
PfeI	GAWTC	3 cut(s)	363, 629, 1008
PflFI	GACNNNGTC	1 cut(s)	146
PkrI	GCNGC	3 cut(s)	172, 814, 817
PleI	GAGTC	1 cut(s)	440
PpsI	GAGTC	1 cut(s)	440
Ppu21I	YACGTR	1 cut(s)	718
PscI	ACATGT	2 cut(s)	755, 831
PshBI	ATTAAT	1 cut(s)	261
Psp1406I	AACGTT	1 cut(s)	704
Psp6I	CCWGG	2 cut(s)	313, 940
PspEI	GGTNACC	1 cut(s)	383
PspFI	CCCAGC	1 cut(s)	575
PspGI	CCWGG	2 cut(s)	313, 940
PspN4I	GGNNCC	1 cut(s)	319
PspPI	GGNCC	2 cut(s)	223, 307
PstI	CTGCAG	2 cut(s)	175, 820
PsyI	GACNNNGTC	1 cut(s)	146
RsaI	GTAC	4 cut(s)	561, 716, 882, 1037
RsaNI	GTAC	4 cut(s)	560, 715, 881, 1036
RseI	CAYNNNNRTG	4 cut(s)	218, 326, 536, 554
SaqAI	TTAA	4 cut(s)	261, 441, 498, 606
SatI	GCNGC	3 cut(s)	171, 813, 816
Sau3AI	GATC	4 cut(s)	29, 193, 543, 610
Sau96I	GGNCC	2 cut(s)	223, 307
SchI	GAGTC	1 cut(s)	441
ScrFI	CCNGG	2 cut(s)	315, 942
SduI	GDGCHC	1 cut(s)	496
SfaNI	GCATC	1 cut(s)	325
SfcI	CTRYAG	3 cut(s)	171, 633, 816
SinI	GGWCC	2 cut(s)	223, 307
SmiMI	CAYNNNNRTG	4 cut(s)	218, 326, 536, 554
Sse9I	AATT	6 cut(s)	201, 696, 732, 746, 980, 1050
SsiI	CCGC	1 cut(s)	226
SspI	AATATT	1 cut(s)	913
SspMI	CTAG	4 cut(s)	68, 179, 666, 788
StyD4I	CCNGG	2 cut(s)	313, 940
StyI	CCWWGG	2 cut(s)	153, 807
TaaI	ACNGT	1 cut(s)	714
TaiI	ACGT	2 cut(s)	707, 720
TaqI	TCGA	5 cut(s)	210, 340, 690, 709, 973
TasI	AATT	6 cut(s)	201, 696, 732, 746, 980, 1050
TfiI	GAWTC	3 cut(s)	363, 629, 1008
Tru1I	TTAA	4 cut(s)	261, 441, 498, 606
Tru9I	TTAA	4 cut(s)	261, 441, 498, 606
TscAI	CASTG	4 cut(s)	180, 220, 235, 924
TseFI	GTSAC	2 cut(s)	328, 383
TseI	GCWGC	3 cut(s)	170, 812, 815
Tsp45I	GTSAC	2 cut(s)	328, 383
TspDTI	ATGAA	5 cut(s)	355, 581, 600, 662, 816
TspRI	CASTG	4 cut(s)	180, 220, 235, 924
Tth111I	GACNNNGTC	1 cut(s)	146
VpaK11BI	GGWCC	2 cut(s)	223, 307
VspI	ATTAAT	1 cut(s)	261
XapI	RAATTY	1 cut(s)	980
XceI	RCATGY	3 cut(s)	759, 835, 928
XmnI	GAANNNNTTC	2 cut(s)	509, 705
XspI	CTAG	4 cut(s)	68, 179, 666, 788

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.