Rroxscaffold_1G00022240

Kiwellin-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
27481934 .. 27483641
1708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00022240.1

Sequence Viewer

Length: 174 bp
ATGGCAAAAAATTCCCTACATTCAAATTCTCGATCGCCACCAATAACGTCATCCACCAGAGCCAAACTCATGCTCAACGACTTCAGCCAAGGCGGTGACCCATCGGAGTACGATGAGAAGTTCCACAAAAAGAGCGAGCTGAATAAATATATTTTATGTATTTTTTATAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.55

Weight (kDa)

9.21

Isoelectric Point (pI)

71.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018914)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 168
AciI CCGC 1 cut(s) 93
AcsI RAATTY 2 cut(s) 10, 25
AcuI CTGAAG 1 cut(s) 67
AfaI GTAC 1 cut(s) 110
AgsI TTSAA 1 cut(s) 24
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
ApoI RAATTY 2 cut(s) 10, 25
AsuHPI GGTGA 1 cut(s) 107
BccI CCATC 1 cut(s) 109
BplI GAGNNNNNCTC 2 cut(s) 51, 83
BsaJI CCNNGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 1 cut(s) 50
Bsh1285I CGRYCG 1 cut(s) 35
BsiEI CGRYCG 1 cut(s) 35
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 1 cut(s) 32
BssT1I CCWWGG 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 137
BstEII GGTNACC 1 cut(s) 95
BstF5I GGATG 1 cut(s) 50
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMCI CGRYCG 1 cut(s) 35
BstPI GGTNACC 1 cut(s) 95
BtsCI GGATG 1 cut(s) 50
Cac8I GCNNGC 1 cut(s) 137
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 70
CviJI RGCY 3 cut(s) 62, 87, 139
CviKI_1 RGCY 3 cut(s) 62, 87, 139
CviQI GTAC 1 cut(s) 109
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
Eco130I CCWWGG 1 cut(s) 88
Eco57I CTGAAG 1 cut(s) 67
Eco91I GGTNACC 1 cut(s) 95
EcoO65I GGTNACC 1 cut(s) 95
EcoT14I CCWWGG 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 1 cut(s) 73
FaiI YATR 4 cut(s) 71, 150, 157, 168
FatI CATG 1 cut(s) 69
FokI GGATG 1 cut(s) 37
Hin1II CATG 1 cut(s) 73
HphI GGTGA 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 47
Hsp92II CATG 1 cut(s) 73
Kzo9I GATC 1 cut(s) 32
LpnPI CCDG 1 cut(s) 70
MaeII ACGT 1 cut(s) 47
MaeIII GTNAC 1 cut(s) 95
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MluCI AATT 2 cut(s) 10, 25
NdeII GATC 1 cut(s) 32
NlaIII CATG 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 95
Ple19I CGATCG 1 cut(s) 35
PsiI TTATAA 1 cut(s) 168
PspEI GGTNACC 1 cut(s) 95
PvuI CGATCG 1 cut(s) 35
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
Sau3AI GATC 1 cut(s) 32
SetI ASST 2 cut(s) 50, 141
SgeI CNNG 5 cut(s) 42, 69, 82, 101, 148
Sse9I AATT 2 cut(s) 10, 25
SsiI CCGC 1 cut(s) 93
StyI CCWWGG 1 cut(s) 88
TaiI ACGT 1 cut(s) 50
TaqI TCGA 1 cut(s) 31
TasI AATT 2 cut(s) 10, 25
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
XapI RAATTY 2 cut(s) 10, 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.