Rroxscaffold_1G00026350

MLP-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
33188111 .. 33191276
3166 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00026350.1

Sequence Viewer

Length: 489 bp
ATGGCTCAAATTGCAAAGATTGAGTCGCACGCAGAGCTGAAATCATCTGCAGAGAAGTTCTATGGCTTTTTCAAGAACAGCATGAGCTCTTTTGTTCAGATGTTCCCTCAAATCTTTAAGAACTTCGAAGTTGTGGGGGAGGAGAGATCAGAGCAGGCTTCGGGTGTGGAAACAACAAAACTTAAAATCCAAGAAGCAGATGATGAAAACACAACGATCACGATCATTGGTCTTGAAGGAGATATTTTGAAGGGTTATAAGAGTTTCAAGGAGAAGCTCCAAGTTATTAAAGCAGGGAGCATAGTGAAATGGGCATTCGAGTGTGAGAAGGCAAATGCAAATGCACCTGATGCAAAGATAGGCATGCGGACCTTTCAGTTAAAGTGCCCAAGGCCATTGATGCTTACCTTTGCAGGACTTGATTCTCATTATAACAAATCAACTCTCTACTCTCTTTCATACCTAGTGGTTAATCAAGTGAGTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

18.15

Weight (kDa)

7.71

Isoelectric Point (pI)

32.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 5 - 119 8.4e-14 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015580)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 258, 432
AciI CCGC 1 cut(s) 367
AgsI TTSAA 4 cut(s) 73, 236, 250, 268
AluBI AGCT 4 cut(s) 37, 87, 277, 486
AluI AGCT 4 cut(s) 37, 87, 277, 486
Alw21I GWGCWC 1 cut(s) 89
AoxI GGCC 1 cut(s) 392
ArsI GACNNNNNNTTYG 2 cut(s) 8, 40
AspS9I GGNCC 1 cut(s) 369
AsuII TTCGAA 1 cut(s) 126
AvaII GGWCC 1 cut(s) 369
BaeGI GKGCMC 1 cut(s) 389
BanII GRGCYC 1 cut(s) 89
Bbv12I GWGCWC 1 cut(s) 89
BfaI CTAG 2 cut(s) 464, 487
BfmI CTRYAG 1 cut(s) 48
Bme18I GGWCC 1 cut(s) 369
BmgT120I GGNCC 1 cut(s) 369
BmsI GCATC 2 cut(s) 340, 390
Bpu14I TTCGAA 1 cut(s) 126
BsaBI GATNNNNATC 1 cut(s) 221
BsaJI CCNNGG 1 cut(s) 389
Bse8I GATNNNNATC 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 389
BseJI GATNNNNATC 1 cut(s) 221
BseRI GAGGAG 1 cut(s) 155
BseSI GKGCMC 1 cut(s) 389
BshFI GGCC 1 cut(s) 394
BsiHKAI GWGCWC 1 cut(s) 89
BsmI GAATGC 1 cut(s) 314
BsnI GGCC 1 cut(s) 394
Bsp119I TTCGAA 1 cut(s) 126
Bsp1286I GDGCHC 2 cut(s) 89, 389
Bsp143I GATC 3 cut(s) 146, 216, 222
BspACI CCGC 1 cut(s) 367
BspANI GGCC 1 cut(s) 394
BspMAI CTGCAG 1 cut(s) 52
BspT104I TTCGAA 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 389
BssMI GATC 3 cut(s) 146, 216, 222
BssT1I CCWWGG 1 cut(s) 389
BstAPI GCANNNNNTGC 1 cut(s) 350
BstBI TTCGAA 1 cut(s) 126
BstC8I GCNNGC 3 cut(s) 30, 156, 365
BstKTI GATC 3 cut(s) 149, 219, 225
BstMBI GATC 3 cut(s) 146, 216, 222
BstMWI GCNNNNNNNGC 4 cut(s) 11, 34, 350, 400
BstNSI RCATGY 1 cut(s) 367
BstSFI CTRYAG 1 cut(s) 48
BstSLI GKGCMC 1 cut(s) 389
BsuRI GGCC 1 cut(s) 394
Cac8I GCNNGC 3 cut(s) 30, 156, 365
Cfr13I GGNCC 1 cut(s) 369
CviAII CATG 2 cut(s) 82, 364
CviJI RGCY 8 cut(s) 5, 37, 66, 87, 158, 277, 394, 486
CviKI_1 RGCY 8 cut(s) 5, 37, 66, 87, 158, 277, 394, 486
DpnI GATC 3 cut(s) 148, 218, 224
DpnII GATC 3 cut(s) 146, 216, 222
Ecl136II GAGCTC 1 cut(s) 87
Eco130I CCWWGG 1 cut(s) 389
Eco24I GRGCYC 1 cut(s) 89
Eco47I GGWCC 1 cut(s) 369
Eco53kI GAGCTC 1 cut(s) 87
EcoICRI GAGCTC 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 389
EcoT38I GRGCYC 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 389
FaeI CATG 2 cut(s) 85, 367
FaiI YATR 7 cut(s) 63, 83, 258, 302, 365, 432, 460
FatI CATG 2 cut(s) 81, 363
FriOI GRGCYC 1 cut(s) 89
FspBI CTAG 2 cut(s) 464, 487
HaeIII GGCC 1 cut(s) 394
Hin1II CATG 2 cut(s) 85, 367
HinfI GANTC 2 cut(s) 23, 422
Hpy188I TCNGA 2 cut(s) 99, 151
Hpy188III TCNNGA 3 cut(s) 73, 220, 233
HpyAV CCTTC 3 cut(s) 230, 244, 322
HpyCH4V TGCA 6 cut(s) 14, 50, 338, 344, 353, 413
HpyF10VI GCNNNNNNNGC 4 cut(s) 11, 34, 350, 400
Hsp92II CATG 2 cut(s) 85, 367
Kzo9I GATC 3 cut(s) 146, 216, 222
LmnI GCTCC 2 cut(s) 282, 297
LpnPI CCDG 4 cut(s) 140, 279, 360, 399
LweI GCATC 2 cut(s) 340, 390
MaeI CTAG 2 cut(s) 464, 487
MalI GATC 3 cut(s) 148, 218, 224
MboI GATC 3 cut(s) 146, 216, 222
MhlI GDGCHC 2 cut(s) 89, 389
MluCI AATT 1 cut(s) 9
MlyI GAGTC 1 cut(s) 32
MnlI CCTC 2 cut(s) 117, 133
MseI TTAA 5 cut(s) 117, 183, 288, 380, 471
MslI CAYNNNNRTG 1 cut(s) 319
Mva1269I GAATGC 1 cut(s) 314
MwoI GCNNNNNNNGC 4 cut(s) 11, 34, 350, 400
NdeII GATC 3 cut(s) 146, 216, 222
NlaIII CATG 2 cut(s) 85, 367
NspI RCATGY 1 cut(s) 367
NspV TTCGAA 1 cut(s) 126
PaeI GCATGC 1 cut(s) 367
PctI GAATGC 1 cut(s) 314
PfeI GAWTC 1 cut(s) 422
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
PsiI TTATAA 2 cut(s) 258, 432
Psp124BI GAGCTC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 369
PstI CTGCAG 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 319
SacI GAGCTC 1 cut(s) 89
SaqAI TTAA 5 cut(s) 117, 183, 288, 380, 471
Sau3AI GATC 3 cut(s) 146, 216, 222
Sau96I GGNCC 1 cut(s) 369
SchI GAGTC 1 cut(s) 32
SduI GDGCHC 2 cut(s) 89, 389
SetI ASST 8 cut(s) 39, 89, 279, 349, 374, 410, 465, 488
SfaNI GCATC 2 cut(s) 340, 390
SfcI CTRYAG 1 cut(s) 48
SfuI TTCGAA 1 cut(s) 126
SinI GGWCC 1 cut(s) 369
SmiMI CAYNNNNRTG 1 cut(s) 319
SphI GCATGC 1 cut(s) 367
Sse9I AATT 1 cut(s) 9
SsiI CCGC 1 cut(s) 367
SspMI CTAG 2 cut(s) 464, 487
SstI GAGCTC 1 cut(s) 89
StyI CCWWGG 1 cut(s) 389
TaqI TCGA 2 cut(s) 126, 318
TasI AATT 1 cut(s) 9
TfiI GAWTC 1 cut(s) 422
Tru1I TTAA 5 cut(s) 117, 183, 288, 380, 471
Tru9I TTAA 5 cut(s) 117, 183, 288, 380, 471
TspDTI ATGAA 2 cut(s) 219, 447
VpaK11BI GGWCC 1 cut(s) 369
XceI RCATGY 1 cut(s) 367
XspI CTAG 2 cut(s) 464, 487
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.