Rw5G033770

MLP-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0015580
Physical Location & Seq
Reverse (-)
57568332 .. 57571806
3475 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G033770.1

Sequence Viewer

Length: 339 bp
ATGGCTCAAATTGCAAAGGTTGAGGATCAAGCAGAGATAAAATTGGCAGCGGACAAGTTCTATGGCTTCTTTAAGAACAAAATAAGCTCTTTTTTCAGATGTAGGGGTGTGGAAACAGCAAAACTTAAAATCCAAGAAGCAGATGATGAAAACACAACGATCACGTTCATTGGTCTTGAAGGAGATATTTTGAAGGGTTATAAGAGTTTCAAGGAGAAGCTCCAAGTTATTAAAGCAGCTAATGGTGGGAGCATAGTGAAATGGACATTCGAGTATAGGCATGCGGACCTTTCAGTTAAAGTGTCGAAGGCCATTGATACTTACCTTTGCAGGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

112

Amino Acids

12.68

Weight (kDa)

9.06

Isoelectric Point (pI)

7.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 37 - 99 1.7e-13 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015580)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g29520 FvH4_3g29530 FvH4_3g29540
malus_domestica MD11G1160200.v1.1
rosa_chinensis RchiOBHm_Chr5g0054611
rosa_laevigata RLG00000034935 RLG00000034939
rosa_multiflora Rmu_sc0019242.1_g000001
rosa_roxburghii Rroxscaffold_1G00026350
rosa_rugosa Rorug05G0287000
rosa_samantha Rh5AG357400 Rh5BG369400 Rh5BG369500 Rh5CG392100
rosa_wichuraiana Rw5G033560 Rw5G033770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 201
AciI CCGC 2 cut(s) 50, 284
AclWI GGATC 1 cut(s) 33
AgsI TTSAA 3 cut(s) 179, 193, 211
AluBI AGCT 3 cut(s) 87, 220, 239
AluI AGCT 3 cut(s) 87, 220, 239
AlwI GGATC 1 cut(s) 33
AoxI GGCC 1 cut(s) 309
ApeKI GCWGC 2 cut(s) 47, 236
AspS9I GGNCC 1 cut(s) 286
AvaII GGWCC 1 cut(s) 286
BbvI GCAGC 2 cut(s) 59, 248
BisI GCNGC 2 cut(s) 48, 237
BlsI GCNGC 2 cut(s) 49, 238
Bme18I GGWCC 1 cut(s) 286
BmgT120I GGNCC 1 cut(s) 286
BseXI GCAGC 2 cut(s) 59, 248
BshFI GGCC 1 cut(s) 311
BsnI GGCC 1 cut(s) 311
Bsp143I GATC 2 cut(s) 25, 159
BspACI CCGC 2 cut(s) 50, 284
BspANI GGCC 1 cut(s) 311
BspPI GGATC 1 cut(s) 33
BssMI GATC 2 cut(s) 25, 159
BstC8I GCNNGC 1 cut(s) 282
BstKTI GATC 2 cut(s) 28, 162
BstMBI GATC 2 cut(s) 25, 159
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNSI RCATGY 1 cut(s) 284
BstV1I GCAGC 2 cut(s) 59, 248
BsuRI GGCC 1 cut(s) 311
Cac8I GCNNGC 1 cut(s) 282
Cfr13I GGNCC 1 cut(s) 286
CviAII CATG 1 cut(s) 281
CviJI RGCY 6 cut(s) 5, 66, 87, 220, 239, 311
CviKI_1 RGCY 6 cut(s) 5, 66, 87, 220, 239, 311
DpnI GATC 2 cut(s) 27, 161
DpnII GATC 2 cut(s) 25, 159
Eco47I GGWCC 1 cut(s) 286
FaeI CATG 1 cut(s) 284
FaiI YATR 5 cut(s) 63, 201, 254, 276, 282
FatI CATG 1 cut(s) 280
Fnu4HI GCNGC 2 cut(s) 48, 237
Fsp4HI GCNGC 2 cut(s) 48, 237
GluI GCNGC 2 cut(s) 48, 237
HaeIII GGCC 1 cut(s) 311
Hin1II CATG 1 cut(s) 284
Hpy188I TCNGA 1 cut(s) 98
Hpy188III TCNNGA 1 cut(s) 176
HpyAV CCTTC 3 cut(s) 173, 187, 301
HpyCH4IV ACGT 1 cut(s) 164
HpyCH4V TGCA 2 cut(s) 14, 330
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 164
Hsp92II CATG 1 cut(s) 284
Kzo9I GATC 2 cut(s) 25, 159
LmnI GCTCC 2 cut(s) 225, 249
LpnPI CCDG 1 cut(s) 316
Lsp1109I GCAGC 2 cut(s) 59, 248
MaeII ACGT 1 cut(s) 164
MalI GATC 2 cut(s) 27, 161
MboI GATC 2 cut(s) 25, 159
MluCI AATT 2 cut(s) 9, 41
MnlI CCTC 1 cut(s) 16
MseI TTAA 4 cut(s) 72, 126, 231, 297
MspA1I CMGCKG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 2 cut(s) 25, 159
NlaIII CATG 1 cut(s) 284
NspI RCATGY 1 cut(s) 284
PaeI GCATGC 1 cut(s) 284
PkrI GCNGC 2 cut(s) 49, 238
PsiI TTATAA 1 cut(s) 201
PspPI GGNCC 1 cut(s) 286
SaqAI TTAA 4 cut(s) 72, 126, 231, 297
SatI GCNGC 2 cut(s) 48, 237
Sau3AI GATC 2 cut(s) 25, 159
Sau96I GGNCC 1 cut(s) 286
SetI ASST 7 cut(s) 21, 89, 167, 222, 241, 291, 327
SgeI CNNG 9 cut(s) 41, 67, 146, 175, 188, 223, 236, 283, 293
SinI GGWCC 1 cut(s) 286
SphI GCATGC 1 cut(s) 284
Sse9I AATT 2 cut(s) 9, 41
SsiI CCGC 2 cut(s) 50, 284
TaiI ACGT 1 cut(s) 167
TaqI TCGA 2 cut(s) 270, 305
TasI AATT 2 cut(s) 9, 41
Tru1I TTAA 4 cut(s) 72, 126, 231, 297
Tru9I TTAA 4 cut(s) 72, 126, 231, 297
TseI GCWGC 2 cut(s) 47, 236
TspDTI ATGAA 2 cut(s) 157, 162
VpaK11BI GGWCC 1 cut(s) 286
XceI RCATGY 1 cut(s) 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.