Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0018101

Physical Location & Seq

Genomic Coordinates Reverse (-)

24904208 .. 24907359

Gene Structure 3152 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00102660.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGCAGATTCTTACCAACGGTAAATACAAGAGTGTGATGCATAGGGCGACTGTGAACAACAAAGCAACGAGGATATCAATGGCTATACCACATGGACCGTCTGTAGATACAACTATTGCTCCAGCTCCAGAGCTGTGTGAAGAGAAGGCAAACATCCCAAGTACCTTGCCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

57

Amino Acids

6.15

Weight (kDa)

9.03

Isoelectric Point (pI)

50.13

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
2OG-FeII_Oxy	PF03171	1 - 31	9.1e-07	2OG-Fe(II) oxygenase superfamily

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018101)

Species	Orthologous Gene IDs
malus_domestica	MD03G1140200.v1.1 MD09G1157200.v1.1
pyrus_communis	pycom03g09530 pycom03g09540
rosa_laevigata	RLG00000036004
rosa_multiflora	Rmu_sc0000076.1_g000056 Rmu_sc0000376.1_g000008
rosa_roxburghii	Rroxscaffold_2G00102660
rosa_samantha	Rh4DG104400 Rh5BG468200 Rh5CG490300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	163
AluBI	AGCT	2 cut(s)	125, 133
AluI	AGCT	2 cut(s)	125, 133
AspS9I	GGNCC	1 cut(s)	95
AvaII	GGWCC	1 cut(s)	95
BfmI	CTRYAG	1 cut(s)	102
Bme18I	GGWCC	1 cut(s)	95
BmgT120I	GGNCC	1 cut(s)	95
BmsI	GCATC	1 cut(s)	27
BpmI	CTGGAG	2 cut(s)	105, 111
BsaXI	ACNNNNNCTCC	2 cut(s)	103, 133
BseGI	GGATG	1 cut(s)	153
Bst4CI	ACNGT	3 cut(s)	20, 52, 99
Bst6I	CTCTTC	1 cut(s)	135
BstF5I	GGATG	1 cut(s)	153
BstSFI	CTRYAG	1 cut(s)	102
BtsCI	GGATG	1 cut(s)	153
Cfr13I	GGNCC	1 cut(s)	95
Csp6I	GTAC	1 cut(s)	162
CviAII	CATG	2 cut(s)	92, 171
CviJI	RGCY	3 cut(s)	83, 125, 133
CviKI_1	RGCY	3 cut(s)	83, 125, 133
CviQI	GTAC	1 cut(s)	162
Eam1104I	CTCTTC	1 cut(s)	135
EarI	CTCTTC	1 cut(s)	135
Eco32I	GATATC	1 cut(s)	75
Eco47I	GGWCC	1 cut(s)	95
EcoRV	GATATC	1 cut(s)	75
EcoT22I	ATGCAT	1 cut(s)	42
FaeI	CATG	2 cut(s)	95, 174
FaiI	YATR	4 cut(s)	42, 86, 93, 172
FatI	CATG	2 cut(s)	91, 170
FokI	GGATG	1 cut(s)	140
GsuI	CTGGAG	2 cut(s)	105, 111
Hin1II	CATG	2 cut(s)	95, 174
HinfI	GANTC	1 cut(s)	7
Hpy166II	GTNNAC	1 cut(s)	55
Hpy188III	TCNNGA	1 cut(s)	128
Hpy8I	GTNNAC	1 cut(s)	55
HpyAV	CCTTC	1 cut(s)	139
HpyCH4III	ACNGT	3 cut(s)	20, 52, 99
HpyCH4V	TGCA	2 cut(s)	4, 40
Hsp92II	CATG	2 cut(s)	95, 174
LmnI	GCTCC	2 cut(s)	124, 130
LpnPI	CCDG	2 cut(s)	135, 141
LweI	GCATC	1 cut(s)	27
MboII	GAAGA	1 cut(s)	152
MnlI	CCTC	1 cut(s)	63
Mph1103I	ATGCAT	1 cut(s)	42
NlaIII	CATG	2 cut(s)	95, 174
NsiI	ATGCAT	1 cut(s)	42
PfeI	GAWTC	1 cut(s)	7
PspPI	GGNCC	1 cut(s)	95
RsaI	GTAC	1 cut(s)	163
RsaNI	GTAC	1 cut(s)	162
Sau96I	GGNCC	1 cut(s)	95
SetI	ASST	3 cut(s)	127, 135, 167
SfaNI	GCATC	1 cut(s)	27
SfcI	CTRYAG	1 cut(s)	102
SgeI	CNNG	5 cut(s)	40, 81, 104, 134, 140
SinI	GGWCC	1 cut(s)	95
TaaI	ACNGT	3 cut(s)	20, 52, 99
TfiI	GAWTC	1 cut(s)	7
VpaK11BI	GGWCC	1 cut(s)	95
Zsp2I	ATGCAT	1 cut(s)	42

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.