Rh4DG104400

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0018101
Physical Location & Seq
Forward (+)
16084736 .. 16085998
1263 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG104400.1

Sequence Viewer

Length: 444 bp
ATGCTAGCGGGGAACTACTACGCTCTTTGCCCTCAGCCAGAACATGCAATCGGTATACCACATCATACAGATCACGGTCTAGTGACACTTCTCATTCAGAATGAGATGAAGGGTCTCAAAGTTGAACACAATGGGAAATGGCTCACTGTCAATGGCCCTGCCAATGGTTTTTTTGTTAACCTTGCTGACCAAACGCAGATTCTTACCAATGGAAAGTACAAGAGTGTGATGCACCGAGCAATTGTGAATAACAAAGCTACAAGGATATCTATAGCCGTACCACATGGACCATCTGTAGATACAATTATTGCACCTTCACCAGAATTGTGTGACAGAGAAGGTCAGGCTCCAAAATACCTTGCAATGAACTACAAGGAATACATACAACTTCAACAAAGTGGCAAGAATTACATGAAGTCAACCTTTGATCACATACGAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

147

Amino Acids

16.39

Weight (kDa)

8.87

Isoelectric Point (pI)

36.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 2 - 95 5.2e-26 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018101)

Species Orthologous Gene IDs
malus_domestica MD03G1140200.v1.1 MD09G1157200.v1.1
pyrus_communis pycom03g09530 pycom03g09540
rosa_laevigata RLG00000036004
rosa_multiflora Rmu_sc0000076.1_g000056 Rmu_sc0000376.1_g000008
rosa_roxburghii Rroxscaffold_2G00102660
rosa_samantha Rh4DG104400 Rh5BG468200 Rh5CG490300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 55
AciI CCGC 1 cut(s) 8
AfaI GTAC 2 cut(s) 218, 279
AfiI CCNNNNNNNGG 1 cut(s) 164
AgsI TTSAA 2 cut(s) 125, 392
AjuI GAANNNNNNNTTGG 2 cut(s) 183, 215
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 154
AspS9I GGNCC 2 cut(s) 155, 287
AsuHPI GGTGA 1 cut(s) 309
AsuNHI GCTAGC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 287
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 298
BceAI ACGGC 1 cut(s) 260
BclI TGATCA 1 cut(s) 427
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 3 cut(s) 5, 80, 442
BfmI CTRYAG 2 cut(s) 270, 294
Bme18I GGWCC 1 cut(s) 287
BmgT120I GGNCC 2 cut(s) 155, 287
BmiI GGNNCC 1 cut(s) 348
BmsI GCATC 1 cut(s) 219
BmtI GCTAGC 1 cut(s) 8
Bpu10I CCTNAGC 1 cut(s) 33
BsaI GGTCTC 1 cut(s) 119
Bsc4I CCNNNNNNNGG 1 cut(s) 164
Bse3DI GCAATG 1 cut(s) 369
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMI GCAATG 1 cut(s) 369
BseMII CTCAG 1 cut(s) 47
BshFI GGCC 1 cut(s) 156
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 156
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 2 cut(s) 70, 427
BspACI CCGC 1 cut(s) 8
BspANI GGCC 1 cut(s) 156
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 1 cut(s) 348
BspOI GCTAGC 1 cut(s) 8
BspTNI GGTCTC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 369
BssMI GATC 2 cut(s) 70, 427
BssNAI GTATAC 1 cut(s) 56
Bst1107I GTATAC 1 cut(s) 56
Bst4CI ACNGT 2 cut(s) 77, 148
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 33
BstKTI GATC 2 cut(s) 73, 430
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 2 cut(s) 70, 427
BstNSI RCATGY 1 cut(s) 47
BstSFI CTRYAG 2 cut(s) 270, 294
BstZ17I GTATAC 1 cut(s) 56
BsuRI GGCC 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 2 cut(s) 155, 287
Csp6I GTAC 2 cut(s) 217, 278
CviAII CATG 3 cut(s) 44, 284, 412
CviJI RGCY 6 cut(s) 37, 142, 156, 257, 275, 347
CviKI_1 RGCY 6 cut(s) 37, 142, 156, 257, 275, 347
CviQI GTAC 2 cut(s) 217, 278
DdeI CTNAG 1 cut(s) 33
DpnI GATC 2 cut(s) 72, 429
DpnII GATC 2 cut(s) 70, 427
Eco31I GGTCTC 1 cut(s) 119
Eco32I GATATC 1 cut(s) 267
Eco47I GGWCC 1 cut(s) 287
EcoRV GATATC 1 cut(s) 267
FaeI CATG 3 cut(s) 47, 287, 415
FaiI YATR 8 cut(s) 45, 56, 66, 272, 285, 383, 413, 434
FalI AAGNNNNNCTT 2 cut(s) 407, 439
FatI CATG 3 cut(s) 43, 283, 411
FbaI TGATCA 1 cut(s) 427
FblI GTMKAC 1 cut(s) 55
FspBI CTAG 3 cut(s) 5, 80, 442
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 3 cut(s) 47, 287, 415
HincII GTYRAC 2 cut(s) 178, 420
HindII GTYRAC 2 cut(s) 178, 420
HinfI GANTC 2 cut(s) 199, 438
HpaI GTTAAC 1 cut(s) 178
HphI GGTGA 1 cut(s) 309
Hpy166II GTNNAC 3 cut(s) 56, 178, 420
Hpy188I TCNGA 1 cut(s) 99
Hpy8I GTNNAC 3 cut(s) 56, 178, 420
HpyAV CCTTC 3 cut(s) 103, 324, 332
HpyCH4III ACNGT 2 cut(s) 77, 148
HpyCH4V TGCA 4 cut(s) 47, 232, 311, 362
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 3 cut(s) 47, 287, 415
Ksp22I TGATCA 1 cut(s) 427
KspAI GTTAAC 1 cut(s) 178
Kzo9I GATC 2 cut(s) 70, 427
LmnI GCTCC 1 cut(s) 352
LpnPI CCDG 4 cut(s) 51, 171, 329, 333
LweI GCATC 1 cut(s) 219
MaeI CTAG 3 cut(s) 5, 80, 442
MaeIII GTNAC 2 cut(s) 82, 329
MalI GATC 2 cut(s) 72, 429
MboI GATC 2 cut(s) 70, 427
MfeI CAATTG 1 cut(s) 240
MluCI AATT 4 cut(s) 240, 303, 323, 406
MnlI CCTC 1 cut(s) 42
MseI TTAA 1 cut(s) 177
MunI CAATTG 1 cut(s) 240
NdeII GATC 2 cut(s) 70, 427
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 3 cut(s) 47, 287, 415
NlaIV GGNNCC 1 cut(s) 348
NmuCI GTSAC 2 cut(s) 82, 329
NspI RCATGY 1 cut(s) 47
PfeI GAWTC 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 348
PspPI GGNCC 2 cut(s) 155, 287
RsaI GTAC 2 cut(s) 218, 279
RsaNI GTAC 2 cut(s) 217, 278
SaqAI TTAA 1 cut(s) 177
Sau3AI GATC 2 cut(s) 70, 427
Sau96I GGNCC 2 cut(s) 155, 287
SetI ASST 6 cut(s) 183, 259, 316, 343, 360, 425
SfaNI GCATC 1 cut(s) 219
SfcI CTRYAG 2 cut(s) 270, 294
SinI GGWCC 1 cut(s) 287
Sse9I AATT 4 cut(s) 240, 303, 323, 406
SsiI CCGC 1 cut(s) 8
SspMI CTAG 3 cut(s) 5, 80, 442
TaaI ACNGT 2 cut(s) 77, 148
TasI AATT 4 cut(s) 240, 303, 323, 406
TatI WGTACW 1 cut(s) 216
TfiI GAWTC 1 cut(s) 199
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 151
TseFI GTSAC 2 cut(s) 82, 329
Tsp45I GTSAC 2 cut(s) 82, 329
TspDTI ATGAA 3 cut(s) 122, 380, 428
TspRI CASTG 1 cut(s) 151
VpaK11BI GGWCC 1 cut(s) 287
XceI RCATGY 1 cut(s) 47
XmiI GTMKAC 1 cut(s) 55
XspI CTAG 3 cut(s) 5, 80, 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.