Rroxscaffold_3G00225450

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
8697777 .. 8698057
281 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00225450.1

Sequence Viewer

Length: 225 bp
ATGGAAATCTTGGTTGCTCTATCTCACAGAAGCAATGGACTCGATGTAGATTGGAGCATCCACCCCAACTTCCTCTCCAAAGAGTCTAGGAAGATGTACACGTTTTTGCTGGAGAATGGCAATGTAGAGCTAGCCAAGGAGCATACTTCCCATGGTCCTTTGATGGAAGGTTTAAAGGGCACAGCTGTAAAAAGAAGGGTCCTGAACATTGTATTTCCAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.36

Weight (kDa)

8.18

Isoelectric Point (pI)

41.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018542)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 98
AflIII ACRYGT 1 cut(s) 99
AluBI AGCT 2 cut(s) 130, 185
AluI AGCT 2 cut(s) 130, 185
AspS9I GGNCC 2 cut(s) 155, 199
AsuNHI GCTAGC 1 cut(s) 130
AvaII GGWCC 2 cut(s) 155, 199
BaeGI GKGCMC 1 cut(s) 182
BccI CCATC 1 cut(s) 157
BcgI CGANNNNNNTGC 2 cut(s) 22, 56
BfaI CTAG 2 cut(s) 87, 131
Bme18I GGWCC 2 cut(s) 155, 199
BmgT120I GGNCC 2 cut(s) 155, 199
BmiI GGNNCC 1 cut(s) 200
BmsI GCATC 1 cut(s) 66
BmtI GCTAGC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 131
BsaJI CCNNGG 2 cut(s) 135, 151
BsaXI ACNNNNNCTCC 2 cut(s) 59, 89
Bse3DI GCAATG 2 cut(s) 40, 127
BseDI CCNNGG 2 cut(s) 135, 151
BseGI GGATG 1 cut(s) 57
BseMI GCAATG 2 cut(s) 40, 127
BseSI GKGCMC 1 cut(s) 182
Bsp1286I GDGCHC 1 cut(s) 182
Bsp1407I TGTACA 1 cut(s) 96
Bsp19I CCATGG 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 200
BspOI GCTAGC 1 cut(s) 134
BsrDI GCAATG 2 cut(s) 40, 127
BsrGI TGTACA 1 cut(s) 96
BssECI CCNNGG 2 cut(s) 135, 151
BssT1I CCWWGG 2 cut(s) 135, 151
BstAUI TGTACA 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 132
BstDSI CCRYGG 1 cut(s) 151
BstF5I GGATG 1 cut(s) 57
BstSLI GKGCMC 1 cut(s) 182
BtgI CCRYGG 1 cut(s) 151
BtsCI GGATG 1 cut(s) 57
Cac8I GCNNGC 1 cut(s) 132
Cfr13I GGNCC 2 cut(s) 155, 199
Csp6I GTAC 1 cut(s) 97
CviAII CATG 1 cut(s) 152
CviJI RGCY 3 cut(s) 130, 134, 185
CviKI_1 RGCY 3 cut(s) 130, 134, 185
CviQI GTAC 1 cut(s) 97
DraI TTTAAA 1 cut(s) 174
Eco130I CCWWGG 2 cut(s) 135, 151
Eco47I GGWCC 2 cut(s) 155, 199
EcoO109I RGGNCCY 1 cut(s) 199
EcoT14I CCWWGG 2 cut(s) 135, 151
ErhI CCWWGG 2 cut(s) 135, 151
FaeI CATG 1 cut(s) 155
FaiI YATR 2 cut(s) 144, 153
FatI CATG 1 cut(s) 151
FokI GGATG 1 cut(s) 44
FspBI CTAG 2 cut(s) 87, 131
GsuI CTGGAG 1 cut(s) 131
Hin1II CATG 1 cut(s) 155
HinfI GANTC 2 cut(s) 39, 83
Hpy166II GTNNAC 1 cut(s) 99
Hpy188III TCNNGA 1 cut(s) 202
Hpy8I GTNNAC 1 cut(s) 99
HpyAV CCTTC 2 cut(s) 161, 189
HpyCH4IV ACGT 1 cut(s) 101
HpySE526I ACGT 1 cut(s) 101
Hsp92II CATG 1 cut(s) 155
LmnI GCTCC 2 cut(s) 54, 139
LpnPI CCDG 2 cut(s) 95, 215
LweI GCATC 1 cut(s) 66
MaeI CTAG 2 cut(s) 87, 131
MaeII ACGT 1 cut(s) 101
MboII GAAGA 1 cut(s) 103
MhlI GDGCHC 1 cut(s) 182
MlyI GAGTC 2 cut(s) 33, 92
MnlI CCTC 1 cut(s) 83
MseI TTAA 1 cut(s) 173
MspA1I CMGCKG 1 cut(s) 185
NcoI CCATGG 1 cut(s) 151
NheI GCTAGC 1 cut(s) 130
NlaIII CATG 1 cut(s) 155
NlaIV GGNNCC 1 cut(s) 200
PleI GAGTC 2 cut(s) 33, 91
PpsI GAGTC 2 cut(s) 33, 91
PpuMI RGGWCCY 1 cut(s) 199
Psp5II RGGWCCY 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 200
PspPI GGNCC 2 cut(s) 155, 199
PspPPI RGGWCCY 1 cut(s) 199
PvuII CAGCTG 1 cut(s) 185
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SaqAI TTAA 1 cut(s) 173
Sau96I GGNCC 2 cut(s) 155, 199
SchI GAGTC 2 cut(s) 33, 92
SduI GDGCHC 1 cut(s) 182
SetI ASST 4 cut(s) 104, 132, 172, 187
SfaNI GCATC 1 cut(s) 66
SgeI CNNG 9 cut(s) 22, 53, 99, 112, 122, 143, 148, 164, 214
SinI GGWCC 2 cut(s) 155, 199
SspMI CTAG 2 cut(s) 87, 131
StyI CCWWGG 2 cut(s) 135, 151
TaiI ACGT 1 cut(s) 104
TaqI TCGA 1 cut(s) 42
TatI WGTACW 1 cut(s) 96
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
VpaK11BI GGWCC 2 cut(s) 155, 199
XspI CTAG 2 cut(s) 87, 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.