Rroxscaffold_3G00227450

SPFH domain / Band 7 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0017776
Physical Location & Seq
Forward (+)
11583162 .. 11583503
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00227450.1

Sequence Viewer

Length: 342 bp
ATGATGTCGTCAACCTCGGTCCTCCCCGATTCATTGGAGTGGTGGGTTTCGGTGCCTAATACCCGTGCGGTTGTGATCGAGCGATTTGGAAAGTACCCCAAGGTGAAGTGGCCCGGAATACGTCGCTTAATTCCATTTGTTGATAAAATCGTAAACGTGGTTTCCTTGAGAGAAAAGACTATTCATATTCGTGCGCAGAACGCTACGACCAGCAATTCTATTCCCCTTTCGGTTTCTGCGGAATTTACAATGATGATTTCGGACCCCGTGCTGGCCTCTTATGAGGTTGACAATCCCGTGGTCGACACTATTGCTCTTGCCCGCCGTACCCTACGTTCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Band_7 Band_7_C

Protein Analysis

113

Amino Acids

12.71

Weight (kDa)

9.86

Isoelectric Point (pI)

37.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Band_7 PF01145 17 - 99 2.5e-12 SPFH domain / Band 7 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017776)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0330681
rosa_laevigata RLG00000030091
rosa_multiflora Rmu_sc0002725.1_g000003 Rmu_sc0004401.1_g000006
rosa_roxburghii Rroxscaffold_3G00227450 Rroxscaffold_4G00319780
rosa_rugosa Rorug01G0090400
rosa_samantha Rh1AG110100 Rh1AG110900 Rh1CG104800 Rh1DG114000
rosa_wichuraiana Rw1G009020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 195
AccB1I GGYRCC 1 cut(s) 52
AccI GTMKAC 1 cut(s) 303
AciI CCGC 3 cut(s) 68, 239, 322
AcsI RAATTY 1 cut(s) 242
AfaI GTAC 2 cut(s) 95, 328
AfiI CCNNNNNNNGG 1 cut(s) 271
AoxI GGCC 2 cut(s) 110, 273
ApoI RAATTY 1 cut(s) 242
AspLEI GCGC 1 cut(s) 196
AspS9I GGNCC 3 cut(s) 19, 111, 262
AsuC2I CCSGG 1 cut(s) 114
AsuHPI GGTGA 1 cut(s) 115
AvaII GGWCC 2 cut(s) 19, 262
BanI GGYRCC 1 cut(s) 52
BceAI ACGGC 1 cut(s) 309
BcgI CGANNNNNNTGC 2 cut(s) 293, 327
BcnI CCSGG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 114
Bme18I GGWCC 2 cut(s) 19, 262
BmgT120I GGNCC 3 cut(s) 19, 111, 262
BmiI GGNNCC 2 cut(s) 54, 264
BmrFI CCNGG 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 187
BpuMI CCSGG 1 cut(s) 114
BsaJI CCNNGG 3 cut(s) 15, 99, 297
Bsc4I CCNNNNNNNGG 1 cut(s) 271
BseDI CCNNGG 3 cut(s) 15, 99, 297
BseLI CCNNNNNNNGG 1 cut(s) 271
BshFI GGCC 2 cut(s) 112, 275
BshNI GGYRCC 1 cut(s) 52
BsiSI CCGG 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 271
BsnI GGCC 2 cut(s) 112, 275
Bsp143I GATC 1 cut(s) 75
BspACI CCGC 3 cut(s) 68, 239, 322
BspANI GGCC 2 cut(s) 112, 275
BspLI GGNNCC 2 cut(s) 54, 264
BspT107I GGYRCC 1 cut(s) 52
BssECI CCNNGG 3 cut(s) 15, 99, 297
BssMI GATC 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 99
BstC8I GCNNGC 2 cut(s) 273, 322
BstDSI CCRYGG 1 cut(s) 297
BstHHI GCGC 1 cut(s) 196
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 200
BstSCI CCNGG 1 cut(s) 112
BsuRI GGCC 2 cut(s) 112, 275
BtgI CCRYGG 1 cut(s) 297
Cac8I GCNNGC 2 cut(s) 273, 322
CfoI GCGC 1 cut(s) 196
Cfr13I GGNCC 3 cut(s) 19, 111, 262
Csp6I GTAC 2 cut(s) 94, 327
CviJI RGCY 2 cut(s) 112, 275
CviKI_1 RGCY 2 cut(s) 112, 275
CviQI GTAC 2 cut(s) 94, 327
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco130I CCWWGG 1 cut(s) 99
Eco47I GGWCC 2 cut(s) 19, 262
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaiI YATR 2 cut(s) 186, 282
FauI CCCGC 1 cut(s) 329
FblI GTMKAC 1 cut(s) 303
FspI TGCGCA 1 cut(s) 195
GlaI GCGC 1 cut(s) 195
HaeIII GGCC 2 cut(s) 112, 275
HapII CCGG 1 cut(s) 114
HhaI GCGC 1 cut(s) 196
Hin6I GCGC 1 cut(s) 194
HinP1I GCGC 1 cut(s) 194
HincII GTYRAC 3 cut(s) 12, 289, 304
HindII GTYRAC 3 cut(s) 12, 289, 304
HinfI GANTC 1 cut(s) 29
HpaII CCGG 1 cut(s) 114
HphI GGTGA 1 cut(s) 115
Hpy166II GTNNAC 4 cut(s) 12, 154, 289, 304
Hpy188I TCNGA 1 cut(s) 262
Hpy8I GTNNAC 4 cut(s) 12, 154, 289, 304
Hpy99I CGWCG 1 cut(s) 126
HpyCH4IV ACGT 3 cut(s) 121, 156, 334
HpyF10VI GCNNNNNNNGC 1 cut(s) 200
HpySE526I ACGT 3 cut(s) 121, 156, 334
HspAI GCGC 1 cut(s) 194
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 3 cut(s) 127, 223, 257
MaeII ACGT 3 cut(s) 121, 156, 334
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MluCI AATT 3 cut(s) 129, 214, 242
MnlI CCTC 4 cut(s) 25, 32, 277, 286
MseI TTAA 1 cut(s) 128
MslI CAYNNNNRTG 2 cut(s) 37, 189
MspI CCGG 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 200
NciI CCSGG 1 cut(s) 114
NdeII GATC 1 cut(s) 75
NlaIV GGNNCC 2 cut(s) 54, 264
NsbI TGCGCA 1 cut(s) 195
PfeI GAWTC 1 cut(s) 29
PspN4I GGNNCC 2 cut(s) 54, 264
PspPI GGNCC 3 cut(s) 19, 111, 262
PsrI GAACNNNNNNTAC 1 cut(s) 319
RsaI GTAC 2 cut(s) 95, 328
RsaNI GTAC 2 cut(s) 94, 327
RseI CAYNNNNRTG 2 cut(s) 37, 189
SalI GTCGAC 1 cut(s) 302
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 3 cut(s) 19, 111, 262
ScrFI CCNGG 1 cut(s) 114
SetI ASST 6 cut(s) 17, 105, 124, 159, 288, 337
SinI GGWCC 2 cut(s) 19, 262
SmiMI CAYNNNNRTG 2 cut(s) 37, 189
SmlI CTYRAG 1 cut(s) 166
SmoI CTYRAG 1 cut(s) 166
Sse9I AATT 3 cut(s) 129, 214, 242
SsiI CCGC 3 cut(s) 68, 239, 322
StyD4I CCNGG 1 cut(s) 112
StyI CCWWGG 1 cut(s) 99
TaiI ACGT 3 cut(s) 124, 159, 337
TaqI TCGA 2 cut(s) 78, 303
TaqII GACCGA 1 cut(s) 7
TasI AATT 3 cut(s) 129, 214, 242
TfiI GAWTC 1 cut(s) 29
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 21, 173
VpaK11BI GGWCC 2 cut(s) 19, 262
XapI RAATTY 1 cut(s) 242
XmiI GTMKAC 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.