Rroxscaffold_4G00298290

tRNA pseudouridine synthase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
18175001 .. 18175576
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00298290.1

Sequence Viewer

Length: 243 bp
ATGGATCCAACTATTGAGTCCGAAATTTTCAAAGCTCTTGAGAAGACAAGACTTTTGATCGGTGATAAGAATGAATCACATTACTCAAGATGTGGTAGGACAAAAAAAGGGAGTTTCGCTGTTGGACAAGTGATTGCTCTCTATTTAAGATCAAACCTCAAGGAAGCAGTGAAAACAAGTGAAGATCCTAGCAACCAAGAACAATATGAAGGTAAAAATCAGGAACTCTATTTTGAAATATAA

Protein Analysis

80

Amino Acids

9.17

Weight (kDa)

5.82

Isoelectric Point (pI)

45.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 12, 179
AcsI RAATTY 1 cut(s) 24
AgsI TTSAA 2 cut(s) 31, 236
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AlwI GGATC 2 cut(s) 12, 179
ApoI RAATTY 1 cut(s) 24
ArsI GACNNNNNNTTYG 2 cut(s) 37, 69
AsuHPI GGTGA 1 cut(s) 74
BamHI GGATCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 50
BfaI CTAG 1 cut(s) 189
BmiI GGNNCC 1 cut(s) 6
BpiI GAAGAC 1 cut(s) 50
BpuEI CTTGAG 3 cut(s) 59, 70, 143
Bsp143I GATC 4 cut(s) 4, 57, 149, 184
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 2 cut(s) 12, 179
BssMI GATC 4 cut(s) 4, 57, 149, 184
BstKTI GATC 4 cut(s) 7, 60, 152, 187
BstMBI GATC 4 cut(s) 4, 57, 149, 184
BstV2I GAAGAC 1 cut(s) 50
BstX2I RGATCY 2 cut(s) 4, 184
BstYI RGATCY 2 cut(s) 4, 184
BtsI GCAGTG 1 cut(s) 174
BtsIMutI CAGTG 1 cut(s) 174
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
DpnI GATC 4 cut(s) 6, 59, 151, 186
DpnII GATC 4 cut(s) 4, 57, 149, 184
FaiI YATR 2 cut(s) 207, 241
FspBI CTAG 1 cut(s) 189
HinfI GANTC 2 cut(s) 17, 74
HphI GGTGA 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 3 cut(s) 38, 87, 221
HpyAV CCTTC 1 cut(s) 203
Kzo9I GATC 4 cut(s) 4, 57, 149, 184
LpnPI CCDG 1 cut(s) 206
MaeI CTAG 1 cut(s) 189
MalI GATC 4 cut(s) 6, 59, 151, 186
MboI GATC 4 cut(s) 4, 57, 149, 184
MboII GAAGA 2 cut(s) 55, 194
MflI RGATCY 2 cut(s) 4, 184
MluCI AATT 1 cut(s) 24
MlyI GAGTC 1 cut(s) 26
MmeI TCCRAC 2 cut(s) 32, 103
MnlI CCTC 1 cut(s) 167
MseI TTAA 1 cut(s) 146
NdeII GATC 4 cut(s) 4, 57, 149, 184
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 74
PleI GAGTC 1 cut(s) 25
PpsI GAGTC 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 2 cut(s) 4, 184
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 4 cut(s) 4, 57, 149, 184
SchI GAGTC 1 cut(s) 26
SetI ASST 3 cut(s) 37, 159, 214
SgeI CNNG 9 cut(s) 50, 60, 99, 140, 172, 189, 201, 209, 233
SmlI CTYRAG 3 cut(s) 38, 85, 158
SmoI CTYRAG 3 cut(s) 38, 85, 158
Sse9I AATT 1 cut(s) 24
SspMI CTAG 1 cut(s) 189
TasI AATT 1 cut(s) 24
TfiI GAWTC 1 cut(s) 74
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TscAI CASTG 1 cut(s) 174
TspDTI ATGAA 2 cut(s) 87, 222
TspRI CASTG 1 cut(s) 174
XapI RAATTY 1 cut(s) 24
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.