Rroxscaffold_4G00321460

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
51005856 .. 51011437
5582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00321460.1

Sequence Viewer

Length: 180 bp
ATGTGGGATCTTTCCTCTCCAACACGCCCTCACCACCGAGGAGAAGGGGACATGTTGTTGCTTTATCTTGGTGATGGCAATAATGATGCTCCCGCACTACATGAGGCCGACATTGGTCTTGCTATGGGTATTCAAGGTTCGAGGTTGCCAAAGAGAGTTCGATATCATTATCTTGGATGA

Protein Analysis

59

Amino Acids

6.57

Weight (kDa)

6.38

Isoelectric Point (pI)

43.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014891)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 93
AclWI GGATC 1 cut(s) 15
AflIII ACRYGT 1 cut(s) 51
AgsI TTSAA 1 cut(s) 134
AlwI GGATC 1 cut(s) 15
AoxI GGCC 1 cut(s) 105
AsuHPI GGTGA 2 cut(s) 23, 83
BccI CCATC 1 cut(s) 68
BmsI GCATC 1 cut(s) 76
BoxI GACNNNNGTC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 37
BseDI CCNNGG 1 cut(s) 37
BseRI GAGGAG 1 cut(s) 54
BshFI GGCC 1 cut(s) 107
BslFI GGGAC 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 107
Bsp143I GATC 1 cut(s) 7
BspACI CCGC 1 cut(s) 93
BspANI GGCC 1 cut(s) 107
BspPI GGATC 1 cut(s) 15
BssECI CCNNGG 1 cut(s) 37
BssMI GATC 1 cut(s) 7
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstNSI RCATGY 1 cut(s) 55
BstPAI GACNNNNGTC 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 7
BstYI RGATCY 1 cut(s) 7
BsuRI GGCC 1 cut(s) 107
CviAII CATG 2 cut(s) 52, 101
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco32I GATATC 1 cut(s) 164
EcoRV GATATC 1 cut(s) 164
FaeI CATG 2 cut(s) 55, 104
FaiI YATR 3 cut(s) 53, 102, 125
FaqI GGGAC 1 cut(s) 62
FatI CATG 2 cut(s) 51, 100
FauI CCCGC 1 cut(s) 100
HaeIII GGCC 1 cut(s) 107
Hin1II CATG 2 cut(s) 55, 104
HphI GGTGA 2 cut(s) 23, 83
HpyAV CCTTC 1 cut(s) 38
Hsp92II CATG 2 cut(s) 55, 104
Kzo9I GATC 1 cut(s) 7
LmnI GCTCC 1 cut(s) 94
LweI GCATC 1 cut(s) 76
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MflI RGATCY 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 5 cut(s) 25, 32, 39, 97, 135
NdeII GATC 1 cut(s) 7
NlaIII CATG 2 cut(s) 55, 104
NspI RCATGY 1 cut(s) 55
PciI ACATGT 1 cut(s) 51
PscI ACATGT 1 cut(s) 51
PshAI GACNNNNGTC 1 cut(s) 114
PsrI GAACNNNNNNTAC 2 cut(s) 121, 153
PsuI RGATCY 1 cut(s) 7
Sau3AI GATC 1 cut(s) 7
SetI ASST 2 cut(s) 139, 146
SfaNI GCATC 1 cut(s) 76
SgeI CNNG 9 cut(s) 36, 50, 64, 80, 104, 113, 131, 146, 153
SsiI CCGC 1 cut(s) 93
TaqI TCGA 2 cut(s) 140, 160
XceI RCATGY 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.