Rroxscaffold_5G00354510

histone-lysine N-methyltransferase activity

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
32976398 .. 32984107
7710 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00354510.1

Sequence Viewer

Length: 159 bp
ATGGTGGAAGTGCAAAACAACTGCCCAATGTGTCCAGTTATCAACCTTCATTTGAAGTGCGGAAGCTTTCCTCAAGCTCTGGTCAATCCCAGGCTACTCAAGATACGGACATGCTGTGCAACCCCTGAACCAATGGAGCCACAAAAGGATATATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.89

Weight (kDa)

7.62

Isoelectric Point (pI)

32.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016213)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G05835
fragaria_vesca FvH4_4g12240
malus_domestica MD04G1028300.v1.1
prunus_persica Prupe.1G177700_v2.0.a1 Prupe.1G177700_v2.0.a1
pyrus_communis pycom04g02490
rosa_chinensis RchiOBHm_Chr4g0409991
rosa_laevigata RLG00000008507
rosa_multiflora Rmu_sc0000365.1_g000085
rosa_roxburghii Rroxscaffold_5G00354510
rosa_rugosa Rorug04G0100600
rosa_samantha Rh4AG158900 Rh4CG169900 Rh4DG153900
rosa_wichuraiana Rw4G013130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 60
AgsI TTSAA 1 cut(s) 55
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 2 cut(s) 66, 77
AluI AGCT 2 cut(s) 66, 77
BciT130I CCWGG 1 cut(s) 91
Bme1390I CCNGG 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 91
BpuEI CTTGAG 2 cut(s) 57, 83
BsaJI CCNNGG 1 cut(s) 89
Bse1I ACTGG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 89
BseNI ACTGG 1 cut(s) 35
BspACI CCGC 1 cut(s) 60
BspLI GGNNCC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 89
Bst2UI CCWGG 1 cut(s) 91
BstNI CCWGG 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 89
CviAII CATG 1 cut(s) 111
CviJI RGCY 4 cut(s) 66, 77, 94, 139
CviKI_1 RGCY 4 cut(s) 66, 77, 94, 139
EcoRII CCWGG 1 cut(s) 89
FaeI CATG 1 cut(s) 114
FaiI YATR 3 cut(s) 112, 152, 154
FatI CATG 1 cut(s) 110
Hin1II CATG 1 cut(s) 114
HindIII AAGCTT 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 56
HpyCH4V TGCA 2 cut(s) 13, 119
Hsp92II CATG 1 cut(s) 114
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 5 cut(s) 48, 65, 76, 103, 138
MnlI CCTC 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 91
NlaIII CATG 1 cut(s) 114
NlaIV GGNNCC 1 cut(s) 138
NspI RCATGY 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 138
ScrFI CCNGG 1 cut(s) 91
SetI ASST 3 cut(s) 48, 68, 79
SgeI CNNG 8 cut(s) 47, 86, 92, 102, 103, 112, 123, 137
SmlI CTYRAG 2 cut(s) 72, 98
SmoI CTYRAG 2 cut(s) 72, 98
SsiI CCGC 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 89
TspDTI ATGAA 1 cut(s) 38
TspGWI ACGGA 1 cut(s) 121
XceI RCATGY 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.