Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0005362

Physical Location & Seq

Genomic Coordinates Reverse (-)

50647213 .. 50651069

Gene Structure 3857 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00202540.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGAAATTTATAATGAAGAAACTAATGACCTTTTGGCTGTAGAGAACCAGAAATTGCATATTCATGAGTGTTTGGAGATGGATTTGGGGACAAGAGTAAGCCTGTATAAGAATGTTGTTGAAGTATATGAAAAAAAAGTTGGAACTATTTTCCAATTAAGCTGTTGGATGCTCCACCCACCACACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000070 GO:0000226 GO:0000278 GO:0000280 GO:0000775 GO:0000776 GO:0000779 GO:0000793 GO:0000819 GO:0001932 GO:0001934 GO:0002376 GO:0002478 GO:0002495 GO:0002504 GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005694 GO:0005737 GO:0005819 GO:0005828 GO:0005829 GO:0005856 GO:0005871 GO:0005874 GO:0005875 GO:0005876 GO:0006810 GO:0006890 GO:0006928 GO:0006996 GO:0007010 GO:0007017 GO:0007018 GO:0007049 GO:0007051 GO:0007052 GO:0007059 GO:0007079 GO:0007080 GO:0007088 GO:0007346 GO:0008017 GO:0008092 GO:0008150 GO:0008608 GO:0009893 GO:0009987 GO:0010562 GO:0010564 GO:0010604 GO:0010965 GO:0015630 GO:0015631 GO:0016043 GO:0016192 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019220 GO:0019222 GO:0019882 GO:0019884 GO:0019886 GO:0022402 GO:0022607 GO:0030071 GO:0030496 GO:0031323 GO:0031325 GO:0031399 GO:0031401 GO:0031974 GO:0031981 GO:0032268 GO:0032270 GO:0032991 GO:0033043 GO:0033044 GO:0033045 GO:0033047 GO:0033674 GO:0034508 GO:0034622 GO:0042325 GO:0042327 GO:0043085 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043515 GO:0043549 GO:0043933 GO:0044085 GO:0044093 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044430 GO:0044444 GO:0044446 GO:0044464 GO:0044877 GO:0045859 GO:0045860 GO:0045937 GO:0048002 GO:0048193 GO:0048285 GO:0048518 GO:0048522 GO:0050000 GO:0050789 GO:0050790 GO:0050794 GO:0051128 GO:0051171 GO:0051173 GO:0051174 GO:0051179 GO:0051233 GO:0051234 GO:0051246 GO:0051247 GO:0051276 GO:0051303 GO:0051305 GO:0051310 GO:0051315 GO:0051338 GO:0051347 GO:0051382 GO:0051383 GO:0051640 GO:0051641 GO:0051649 GO:0051656 GO:0051726 GO:0051783 GO:0051983 GO:0060255 GO:0065003 GO:0065004 GO:0065007 GO:0065009 GO:0070013 GO:0070925 GO:0071824 GO:0071840 GO:0072686 GO:0080090 GO:0098687 GO:0098813 GO:0099080 GO:0099081 GO:0099512 GO:0099513 GO:0099606 GO:0099607 GO:0140014 GO:1901987 GO:1901990 GO:1902099 GO:1902850 GO:1903047 GO:1905818 GO:1990023

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kinesin

Protein Analysis

62

Amino Acids

7.33

Weight (kDa)

5.14

Isoelectric Point (pI)

40.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005362)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G59540 AT1G59540
fragaria_vesca	FvH4_2g32710 FvH4_2g32710 FvH4_2g32710 FvH4_2g32710 FvH4_2g32710
malus_domestica	MD07G1107700.v1.1 MD08G1078700.v1.1 MD15G1065700.v1.1
prunus_persica	Prupe.1G419600_v2.0.a1 Prupe.1G419600_v2.0.a1
pyrus_communis	pycom08g06510 pycom15g06210 pycom16g20420
rosa_chinensis	RchiOBHm_Chr6g0309971
rosa_laevigata	RLG00000010520 RLG00000032729
rosa_multiflora	Rmu_sc0000294.1_g000009 Rmu_sc0000507.1_g000001
rosa_roxburghii	Rroxscaffold_7G00158990 Rroxscaffold_7G00202540
rosa_rugosa	Rorug06G0376300 Rorug06G0376400.1
rosa_samantha	Rh6AG490200 Rh6BG499700 Rh6CG504500 Rh6DG490600
rosa_wichuraiana	Rw6G042670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	12
AcsI	RAATTY	1 cut(s)	6
AgsI	TTSAA	1 cut(s)	122
AjuI	GAANNNNNNNTTGG	2 cut(s)	123, 155
AluBI	AGCT	1 cut(s)	162
AluI	AGCT	1 cut(s)	162
ApoI	RAATTY	1 cut(s)	6
BccI	CCATC	1 cut(s)	73
BfaI	CTAG	1 cut(s)	187
BfmI	CTRYAG	1 cut(s)	39
BmsI	GCATC	1 cut(s)	159
BseGI	GGATG	1 cut(s)	174
BslFI	GGGAC	1 cut(s)	103
BsmFI	GGGAC	1 cut(s)	103
BspHI	TCATGA	1 cut(s)	64
BstF5I	GGATG	1 cut(s)	174
BstSFI	CTRYAG	1 cut(s)	39
BtsCI	GGATG	1 cut(s)	174
CciI	TCATGA	1 cut(s)	64
CviAII	CATG	1 cut(s)	65
CviJI	RGCY	3 cut(s)	38, 102, 162
CviKI_1	RGCY	3 cut(s)	38, 102, 162
FaeI	CATG	1 cut(s)	68
FaiI	YATR	6 cut(s)	12, 60, 66, 108, 127, 129
FaqI	GGGAC	1 cut(s)	103
FatI	CATG	1 cut(s)	64
FokI	GGATG	1 cut(s)	181
FspBI	CTAG	1 cut(s)	187
Hin1II	CATG	1 cut(s)	68
Hpy188III	TCNNGA	1 cut(s)	65
HpyCH4V	TGCA	1 cut(s)	58
Hsp92II	CATG	1 cut(s)	68
LmnI	GCTCC	1 cut(s)	177
LpnPI	CCDG	2 cut(s)	62, 116
LweI	GCATC	1 cut(s)	159
MaeI	CTAG	1 cut(s)	187
MboII	GAAGA	1 cut(s)	29
MluCI	AATT	3 cut(s)	6, 53, 155
MmeI	TCCRAC	2 cut(s)	121, 146
MseI	TTAA	1 cut(s)	158
MslI	CAYNNNNRTG	1 cut(s)	63
NlaIII	CATG	1 cut(s)	68
PagI	TCATGA	1 cut(s)	64
PsiI	TTATAA	1 cut(s)	12
RseI	CAYNNNNRTG	1 cut(s)	63
SaqAI	TTAA	1 cut(s)	158
SetI	ASST	2 cut(s)	33, 164
SfaNI	GCATC	1 cut(s)	159
SfcI	CTRYAG	1 cut(s)	39
SgeI	CNNG	4 cut(s)	61, 77, 105, 115
SmiMI	CAYNNNNRTG	1 cut(s)	63
Sse9I	AATT	3 cut(s)	6, 53, 155
SspMI	CTAG	1 cut(s)	187
TasI	AATT	3 cut(s)	6, 53, 155
Tru1I	TTAA	1 cut(s)	158
Tru9I	TTAA	1 cut(s)	158
TspDTI	ATGAA	3 cut(s)	30, 53, 144
XapI	RAATTY	1 cut(s)	6
XspI	CTAG	1 cut(s)	187

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.