Rorug01G0330300

SLT1 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0007681
Physical Location & Seq
Forward (+)
44887142 .. 44887701
560 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0330300.1

Sequence Viewer

Length: 285 bp
ATGGTGCTGGTTGAAACAGAAGGATCCTACACTAATGAAAGCCCCATGGATTCTGTTGATGTACGTGGTGGACAGTCCTACTCTGTGCTTGTCACAGCTGATCAAGCCACTTCAGACTATTACATGGTAGCAACTCCTAAATTGCTTAATATCACTGATATGACCAAATTTGGAATTGGTGTGCTGGACTATGATAACTCCACCACAGTTGCTGGTGGACCTCTACCAATTGGCCCTGATCTGTTTGATCTAGACTTCTCCATCAAACCAAGCCAAGTCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.09

Weight (kDa)

4.05

Isoelectric Point (pI)

34.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase PF00394 1 - 66 1.5e-13 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 18, 31
AcsI RAATTY 1 cut(s) 167
AcuI CTGAAG 1 cut(s) 96
AfaI GTAC 1 cut(s) 63
AgsI TTSAA 1 cut(s) 14
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
AlwI GGATC 2 cut(s) 18, 31
AlwNI CAGNNNCTG 1 cut(s) 212
AoxI GGCC 1 cut(s) 232
ApoI RAATTY 1 cut(s) 167
AspS9I GGNCC 2 cut(s) 218, 233
AvaII GGWCC 1 cut(s) 218
BamHI GGATCC 1 cut(s) 23
BccI CCATC 1 cut(s) 269
BclI TGATCA 1 cut(s) 100
BfaI CTAG 1 cut(s) 251
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 2 cut(s) 218, 233
BmiI GGNNCC 1 cut(s) 25
BsaAI YACGTR 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 45
BshFI GGCC 1 cut(s) 234
BsnI GGCC 1 cut(s) 234
Bsp143I GATC 4 cut(s) 23, 100, 238, 247
Bsp19I CCATGG 1 cut(s) 45
BspANI GGCC 1 cut(s) 234
BspLI GGNNCC 1 cut(s) 25
BspPI GGATC 2 cut(s) 18, 31
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 4 cut(s) 23, 100, 238, 247
BssT1I CCWWGG 1 cut(s) 45
Bst4CI ACNGT 2 cut(s) 75, 208
BstBAI YACGTR 1 cut(s) 65
BstDSI CCRYGG 1 cut(s) 45
BstKTI GATC 4 cut(s) 26, 103, 241, 250
BstMBI GATC 4 cut(s) 23, 100, 238, 247
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstX2I RGATCY 1 cut(s) 23
BstYI RGATCY 1 cut(s) 23
BsuRI GGCC 1 cut(s) 234
BtgI CCRYGG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 153
CaiI CAGNNNCTG 1 cut(s) 212
Cfr13I GGNCC 2 cut(s) 218, 233
Csp6I GTAC 1 cut(s) 62
CspCI CAANNNNNGTGG 2 cut(s) 190, 225
CviAII CATG 2 cut(s) 46, 124
CviJI RGCY 5 cut(s) 42, 98, 107, 234, 273
CviKI_1 RGCY 5 cut(s) 42, 98, 107, 234, 273
CviQI GTAC 1 cut(s) 62
DpnI GATC 4 cut(s) 25, 102, 240, 249
DpnII GATC 4 cut(s) 23, 100, 238, 247
Eco130I CCWWGG 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 1 cut(s) 96
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 2 cut(s) 49, 127
FaiI YATR 4 cut(s) 47, 125, 161, 192
FatI CATG 2 cut(s) 45, 123
FbaI TGATCA 1 cut(s) 100
FspBI CTAG 1 cut(s) 251
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 2 cut(s) 49, 127
HinfI GANTC 1 cut(s) 50
Hpy166II GTNNAC 2 cut(s) 71, 218
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 251
Hpy8I GTNNAC 2 cut(s) 71, 218
HpyAV CCTTC 1 cut(s) 14
HpyCH4III ACNGT 2 cut(s) 75, 208
HpyCH4IV ACGT 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpySE526I ACGT 1 cut(s) 64
Hsp92II CATG 2 cut(s) 49, 127
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 4 cut(s) 23, 100, 238, 247
LpnPI CCDG 3 cut(s) 170, 198, 249
MaeI CTAG 1 cut(s) 251
MaeII ACGT 1 cut(s) 64
MaeIII GTNAC 1 cut(s) 91
MalI GATC 4 cut(s) 25, 102, 240, 249
MboI GATC 4 cut(s) 23, 100, 238, 247
MfeI CAATTG 1 cut(s) 228
MflI RGATCY 1 cut(s) 23
MluCI AATT 4 cut(s) 140, 167, 174, 228
MnlI CCTC 1 cut(s) 231
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 158
MspA1I CMGCKG 1 cut(s) 98
MunI CAATTG 1 cut(s) 228
MwoI GCNNNNNNNGC 1 cut(s) 104
NcoI CCATGG 1 cut(s) 45
NdeII GATC 4 cut(s) 23, 100, 238, 247
NlaIII CATG 2 cut(s) 49, 127
NlaIV GGNNCC 1 cut(s) 25
NmuCI GTSAC 1 cut(s) 91
PfeI GAWTC 1 cut(s) 50
Ppu21I YACGTR 1 cut(s) 65
PspN4I GGNNCC 1 cut(s) 25
PspPI GGNCC 2 cut(s) 218, 233
PstNI CAGNNNCTG 1 cut(s) 212
PsuI RGATCY 1 cut(s) 23
PvuII CAGCTG 1 cut(s) 98
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
RseI CAYNNNNRTG 1 cut(s) 158
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 4 cut(s) 23, 100, 238, 247
Sau96I GGNCC 2 cut(s) 218, 233
SetI ASST 3 cut(s) 67, 100, 223
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 1 cut(s) 158
Sse9I AATT 4 cut(s) 140, 167, 174, 228
SspMI CTAG 1 cut(s) 251
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 2 cut(s) 75, 208
TaiI ACGT 1 cut(s) 67
TasI AATT 4 cut(s) 140, 167, 174, 228
TfiI GAWTC 1 cut(s) 50
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 160
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 51
TspRI CASTG 1 cut(s) 160
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 1 cut(s) 167
XbaI TCTAGA 1 cut(s) 250
XspI CTAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.