Rorug02G0016300

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
1379933 .. 1380085
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0016300.1

Sequence Viewer

Length: 153 bp
ATGAATTTTGGTTTTTCAGTTTCTTTTTCCATCATTTTTTTTTTCTGGGTTTTGAAATTTGATGCTTGGTTGATTTGTGTAGTGGGAAAGATTGGGCTTTTATTGAAATTTTCATCAACAAGGAGTCTGCTATGTATTGTTGAAATTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.77

Weight (kDa)

7.8

Isoelectric Point (pI)

23.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016167)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G28850
fragaria_vesca FvH4_7g07550
malus_domestica MD02G1057800.v1.1 MD15G1192200.v1.1
prunus_persica Prupe.7G225000_v2.0.a1
pyrus_communis pycom02g04690 pycom15g17210
rosa_chinensis RchiOBHm_Chr2g0091321
rosa_laevigata RLG00000016211
rosa_multiflora Rmu_sc0002270.1_g000048
rosa_roxburghii Rroxscaffold_2G00150210
rosa_rugosa Rorug02G0016300
rosa_samantha Rh2CG062600 Rh2DG061200
rosa_wichuraiana Rw2G004840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 4, 56, 107
AgsI TTSAA 4 cut(s) 55, 106, 143, 149
ApoI RAATTY 3 cut(s) 4, 56, 107
BccI CCATC 1 cut(s) 38
BmsI GCATC 1 cut(s) 52
CviJI RGCY 1 cut(s) 97
CviKI_1 RGCY 1 cut(s) 97
FaiI YATR 1 cut(s) 133
FspEI CC 9 cut(s) 31, 32, 43, 52, 68, 69, 78, 79, 106
HinfI GANTC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 31
LweI GCATC 1 cut(s) 52
MluCI AATT 4 cut(s) 4, 56, 107, 144
MlyI GAGTC 1 cut(s) 133
PleI GAGTC 1 cut(s) 132
PpsI GAGTC 1 cut(s) 132
SchI GAGTC 1 cut(s) 133
SfaNI GCATC 1 cut(s) 52
SgeI CNNG 3 cut(s) 58, 78, 132
Sse9I AATT 4 cut(s) 4, 56, 107, 144
TasI AATT 4 cut(s) 4, 56, 107, 144
TspDTI ATGAA 2 cut(s) 17, 102
XapI RAATTY 3 cut(s) 4, 56, 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.