Rorug02G0139500

Maternal effect embryo arrest 59

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
12287544 .. 12287747
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0139500.1

Sequence Viewer

Length: 204 bp
ATGAACTCGTTCGGTGATGGGTACGAGATAGTTCTGAGCCAAAGTCCCTCAACTGCTAATGTAATTGCTCAACAATCTCACAAGCTCTATCAGATTAGGAAGATCTTTGCGAAGATAAGAAATGCTCAGAGGTGGAAGAGAGCTAGGGCCATTAGAAGGGATCAATGGTTGGCTAGAAACAAAGGCAAGCCTATAGGAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.8

Weight (kDa)

11.59

Isoelectric Point (pI)

63.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012315)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 168
AfaI GTAC 1 cut(s) 23
AfiI CCNNNNNNNGG 1 cut(s) 156
AluBI AGCT 2 cut(s) 85, 143
AluI AGCT 2 cut(s) 85, 143
AlwI GGATC 1 cut(s) 168
AoxI GGCC 1 cut(s) 147
Asp700I GAANNNNTTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 26
BccI CCATC 1 cut(s) 11
BfaI CTAG 2 cut(s) 144, 174
BfmI CTRYAG 1 cut(s) 192
BglII AGATCT 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 156
BseLI CCNNNNNNNGG 1 cut(s) 156
BseMII CTCAG 2 cut(s) 26, 140
BshFI GGCC 1 cut(s) 149
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 156
BsmFI GGGAC 1 cut(s) 30
BsnI GGCC 1 cut(s) 149
Bsp143I GATC 2 cut(s) 102, 160
BspANI GGCC 1 cut(s) 149
BspCNI CTCAG 2 cut(s) 27, 139
BspPI GGATC 1 cut(s) 168
BssMI GATC 2 cut(s) 102, 160
Bst6I CTCTTC 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 188
BstDEI CTNAG 2 cut(s) 35, 126
BstKTI GATC 2 cut(s) 105, 163
BstMBI GATC 2 cut(s) 102, 160
BstSFI CTRYAG 1 cut(s) 192
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
BsuRI GGCC 1 cut(s) 149
Cac8I GCNNGC 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 147
Csp6I GTAC 1 cut(s) 22
CviJI RGCY 6 cut(s) 39, 85, 143, 149, 173, 190
CviKI_1 RGCY 6 cut(s) 39, 85, 143, 149, 173, 190
CviQI GTAC 1 cut(s) 22
DdeI CTNAG 2 cut(s) 35, 126
DpnI GATC 2 cut(s) 104, 162
DpnII GATC 2 cut(s) 102, 160
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
FaiI YATR 1 cut(s) 194
FaqI GGGAC 1 cut(s) 30
FspBI CTAG 2 cut(s) 144, 174
HaeIII GGCC 1 cut(s) 149
HphI GGTGA 1 cut(s) 26
Hpy188I TCNGA 3 cut(s) 36, 93, 129
HpyAV CCTTC 1 cut(s) 150
HpyF3I CTNAG 2 cut(s) 35, 126
Kzo9I GATC 2 cut(s) 102, 160
MaeI CTAG 2 cut(s) 144, 174
MalI GATC 2 cut(s) 104, 162
MboI GATC 2 cut(s) 102, 160
MboII GAAGA 3 cut(s) 112, 124, 148
MflI RGATCY 1 cut(s) 102
MluCI AATT 1 cut(s) 63
MnlI CCTC 2 cut(s) 58, 123
MroXI GAANNNNTTC 1 cut(s) 8
NdeII GATC 2 cut(s) 102, 160
PdmI GAANNNNTTC 1 cut(s) 8
PspPI GGNCC 1 cut(s) 147
PsuI RGATCY 1 cut(s) 102
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
Sau3AI GATC 2 cut(s) 102, 160
Sau96I GGNCC 1 cut(s) 147
SetI ASST 3 cut(s) 87, 134, 145
SfcI CTRYAG 1 cut(s) 192
SgeI CNNG 6 cut(s) 19, 37, 94, 156, 186, 199
Sse9I AATT 1 cut(s) 63
SspMI CTAG 2 cut(s) 144, 174
TasI AATT 1 cut(s) 63
TspDTI ATGAA 1 cut(s) 17
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 2 cut(s) 144, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.